1. Name the two major divisions of the nervous system; list the organs/tissues found in each.
2. Name the two divisions of the peripheral nervous system (PNS), and give the primary function of each.
3. List at least seven stimuli that would trigger sensory receptors.
4a) Choose one stimulus from Q. 3, and describe in a complete sentence how the stimulus would travel to the central nervous system (CNS).
4b) Describe in 1-2 complete sentences how the motor commands from the CNS would travel to the effector target organ or tissue. Tell if the motor command will travel via the somatic or autonomic nervous system; explain why.
2

5. Choose another stimulus from Q. 3 that will initiate a CNS motor response that will travel via the other motor division (SNS/ANS) of the peripheral nervous system (PNS) described in Q. 5. Explain your reasoning.

Answers

Answer 1

Answer:

1.Structural Divisions of the Nervous System. The nervous system can be divided into two major regions: the central and peripheral nervous systems. The central nervous system (CNS) is the brain and spinal cord, and the peripheral nervous system (PNS) is everything else.

2.Like the nervous system as a whole, the peripheral nervous system also has two divisions: the sensory division and the motor division. The sensory division of the PNS carries sensory information from the body to the central nervous system.

3.Sensory receptors with corresponding stimuli to which they respond.

Receptor Stimulus

Apmullae of Lorenzini (primarily function as electroreceptors) Electric fields, salinity, and temperature

Baroreceptors Pressure in blood vessels

Chemo receptors Chemical stimuli

Electromagnetic radiation receptors Electromagnetic radiation

Electroreceptors Electrofields

Hydroreceptors Humidity

Infrared receptors Infrared radiation

Magnetoreceptors Magnetic fields

Mechanoreceptors Mechanical stress or strain

Nociceptors Damage or threat of damage to body tissues (leads to pain perception)

Osmoreceptors Osmolarity of fluids

Photoreceptors Visible light

Proprioceptors Sense of position

Thermoreceptors Temperature

Ultraviolet receptors Ultraviolet radiation


Related Questions

Explain how autotrophs need both cellular respiration and photosynthesis

Answers

Answer:

They get energy from food. Autotrophs make their own food through the process of photosynthesis, in which light energy from the sun is changed to chemical energy that is stored in glucose. And as for cellular respiration, all organisms use it to break down glucose, release its energy, and make ATP.

Explanation:

_____________

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

A chemical reaction that has the general formula of nA → (A)n is best classified as a
reaction.

Answers

Answer:

true

Explanation:

Answer:

Polymerization

Explanation:

explain in details the mechanism of transportation in plants​

Answers

Answer:

Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.

Explanation:

I hope I helped:)

What is the main feature of frog?

Answers

Answer:

In general, frogs have protruding eyes, no tail, and strong, webbed hind feet that are adapted for leaping and swimming. They also possess smooth, moist skins. Many are predominantly aquatic, but some live on land, in burrows, or in trees. A number depart from the typical form.

In general, frogs have protruding eyes, no tail, and strong, webbed hind feet that are adapted for leaping and swimming. They also possess smooth, moist skins. Many are predominantly aquatic, but some live on land, in burrows, or in trees. A number depart from the typical form.

What is a major difference between DNA replication and DNA transcription?
A. RNA molecules produced by transcription are much shorter in length than DNA molecules produced by replication.
B. DNA replication involves the nitrogenous base uracil, while DNA transcription involves the nitrogenous base thymine.
C. DNA transcription only occurs in multicellular organisms, while DNA replication occurs in all organisms.
D. DNA replication takes place in the nucleus, while DNA transcription takes place in the cytoplasm.

Answers

Answer: Your answer is A

Explanation: I just took the test

the answer is a. hope this helps!

When a strong acid is added to a strong base a_________________ reaction occurs in the product will have a PH closer to_____

A. Neutralization,7
B. Ionic,0
C. Concentration,14

Answers

Answer:

A

Explanation:

Acids and bases when mixed neutralize eachother. and 7 is neutral on the PH scale

How do humans generate energy when oxygen is not available?

a. Using Kreb’s Cycle only
b. Using the Electron Transport Chain only
c. Using alcoholic fermentation
d. Using lactic acid fermentation

Answers

When Oxygen is not available, the cell is forced to produce energy (=ATP) through ANAEROBIC processes, that produce much less energy (about 15 times less), than AEROBIC processes. ... The electron transport chain (ETC) allows the cell to produce energy (ATP) by creating a proton gradient across the mitochondrial membrane. So B.

how can pioneer species benefit the whole biological community?

Answers

Explanation:

"Over hundreds of years these “pioneer species” convert the rock into soil that can support simple plants such as grasses. These grasses further modify the soil, which is then colonized by other types of plants. Each successive stage modifies the habitat by altering the amount of shade and the composition of the soil."

When a human cell divides in mitosis, the two daughter cells will each have: _____

Answers

Answer: In mitosis a cell divides to form two identical daughter cells. It is important that the daughter cells have a copy of every chromosome, so the process involves copying the chromosomes first and then carefully separating the copies to give each new cell a full set. Before mitosis, the chromosomes are copied.

What do living things need to live and grow?

Answers

Answer:

All living things need some form of water. Most need oxygen.

Explanation:

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

In the experiment, which of the following variables should remain consistent?
the types of plants used
the temperature of the water and vinegar
the type of soil used
All of these choices are correct.

Answers

All of the above is correct

Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.


dissolved oxygen in water

treated waste water

viruses

combined sewage overflow (CSO)

fertilizers

cleaning products

dog poop on the streets of NYC

water running over rocks


(This is 7th grade science)

Answers

I’m not sure about the rest but I think Dog poop is one

Which of the following is a method used to obtain the relative age of a rock or fossil?

a
Decay rates

b
Radiometric dating

c
Superposition

d
Uniformitarianism

i know its not radiometric dating

Answers

Answer:

Radiometric dating

Explanation:

What type of energy has to do with a change in temperature?

Answers

Answer: changes in heat energy change temperature

Explanation: heat energy can be thought of as energy in individual atoms or molecules, which vibrate more as energy increases. Temperature is a measure of heat energy. For example, many substances expand as heat energy causes it atoms/molecules to vibrate more and occupy more space. We can use this property to measure energy as temperature by using the expansion of a liquid as in thermonmeters.

Which of the following processes provides the link between solar energy and multi-cellular life on earth?

Answers

Answer:

Out of "the", "following", and "processes" The answer is simply solar energy to life "Processes"

Explanation:

9.Supposed 100 ants live in an & square cenoneter cs: pot gasswould be the population density of the ants?
A.12.5 per cm²
B.12.6 per cm²
C.12.7 per cm²
D.12.8 per cm²​

Answers

The answer is A-12.5 per cm

What are two tools that can be used to measure wind direction?

Answers

Answer:

it should be a wind vane and an anemometer.

Explanation:

The anemometer measures wind speed and the wind vane helps determine what direction the wind is coming from.

A moth population living in a deciduous forest relies on camouflage to protect itself from predators. These moths typically vary in
color and are thus able to camouflage among both the light and dark-colored trees of the forest. However, as soot emitted from
nearby factories darkens the forests trees, the moth population begins to evolve. Which of the following distribution graphs best
represents the evolution of this moth population?

Answers

The distribution of graph A best represents the evolution of this moth population.

What do you mean by Evolution?

Evolution is defined as the process of growth and development or the theory that organisms have grown and developed from past organisms.

As soot emitted from nearby factories darken the trees of the forest, it is better to camouflage dark to escape from predators. And in this way evolution of the moth population takes place.

Therefore, the distribution of graph A best represents the evolution of this moth population.

To learn more about Moth evolution, refer to the link:

https://brainly.com/question/2050596

how does Pteromyzon differ from scolidon and labeo fishes?
who answer this question in 10 seconds I'll mark his or her ans. as "BRAINLIST ANSWER"
It's my promise but the answer must not be copied from internet​

Answers

Answer:

Due to agnathous, no paired fins and scales.

Explanation:

Pteromyzon fish is different from scolidon and labeo fishes because Pteromyzon fish is not a true fish. The main reason for this is that Pteromyzon fish is agnathous means having no jaws and it doesn't have paired fins and scales on their body while all these features are present on the body of  scolidon and labeo fishes so we can conclude from this discussion that Pteromyzon fish is different from scolidon and labeo fishes.

7.) DURING THE FIRST ERA, THE __________ ORGANISMS EVER ON EARTH WERE
ERA, THE FIRST LIVING

Answers

Answer:

The first living organism on Earth are Bacteria in the first era.

Explanation:

Bacteria are the first organism to leave be on Earth. They came into existence about 3.5 billion years in the first era in the waters of small oceans. Then there were anaerobic hetetrophic bacteria because the atmosphere was free of oxygen before. Cyanobacteria then became the first autotrophic organisms and first photosynthesizer that release oxygen to the atmosphere after photosynthesis.

Read the quotation below from a high school science student.
We used a formal method of study to figure out which kind
of grocery bag had the least effect on the environment.
What is the student describing?
O A. Using scientific tools
B. Making random discoveries
C. Using the scientific method
D. Making a conclusion

Answers

Answer:

C. Using the scientific method

Please help worth 95 points. Project: Algae Cultures: Directions
In this report, you will be researching the different types of algae. Report on one algae from each of the three categories (blue-green, green, and green-brown). Include the following information: Name of the algae, Category if falls under, Where it is mostly found and what conditions it needs to survive, Whether it is unicellular or multicellular, Where in the food chain algae are, and what predators it may have, Research why some scientists think algae should be classified plants, and explain the debate.

1.Which organisms did you identify 2. How easy or difficult was it to find an example of each category? Which one was the hardest to find? Why? 3. Which environments were most common to find algae in? Why do you think so? 4. What part of the food chain is the alga? 5. Why is algae classified in the Protist Kingdom and not the Plant Kingdom even though they are photosynthetic? Research why scientists feel they should be classified as plants.

Answers

Answer:

1) I identified the Golden-Brown Algae.

2)  It was very easy to find the category because of the solid color base and because it only had the daitoms. It did not have multiple like the Green Algae and the Blue-Green Algae.

3) In fresh, brackish or salt water. They are found both in tropical lakes and seas, and in the alpine and polar snows. They are unicellular or multicellular protist plant organisms, whose cells do not form tissues and lack flowers. They are considered the first link in the food chain in the aquatic environment. They are found in fresh, brackish or salt water. They are primary producers in the food chain, capable of producing organic substances through photosynthesis, so they use sunlight. They are found in tropical lakes and seas up to the alpine and polar snows.

4) Producer Alga is A plant and produces food for other organisms.

5) Algae (Euglena) do photosynthesis as plants do. They also move around and eat, as do animals. But they are unicellular. In order to be classified as a plant or animal, an organism has to be multicellular, made of more than one cell. Since it is a unicellular organism with some plant and animal characteristics, it is called a protist. Plant cells have walls while algae does't have one, so it is a protozoan. Algae resemble the protozoa, so they are put into the Protist Kingdom.

Explanation:

I had the project.

Algae recreate a major part of the marine ecosystem because they exist as the decomposers current in the marine ecosystem; any harm to them could cause an inequality in the whole marine ecosystem.

What are golden-brown algae?

1)The Chrysophyceae, usually named chrysophytes, cryptomonads, golden-brown algae or golden algae exist as an extensive set of algae, seen mainly in freshwater.

2) It stood very easy to see the class because of the solid color base and because it only contained the diatoms. It did not contain multiple like the Green Algae and the Blue-Green Algae.

3) In fresh, saline, or salt water. They exist seen both in tropical lakes and seas and in the alpine and polar snows. They exist as unicellular or multicellular protist plant organisms, whose cells do not constitute tissues and absent flowers. They exist thought the first link in the food chain in the aquatic environment. They exist seen in fresh, brackish, or salt water. They exist as primary producers in the food chain, qualified of producing organic substances through photosynthesis, so they utilize sunlight.

4) Producer Alga exists in a plant and makes food for different organisms.

5) Algae (Euglena) accomplish photosynthesis as plants do. They even move about and eat, as do animals. But they exist unicellular. To be categorized as a plant or animal, an organism contains to be multicellular, made of better than one cell. Since it stands as a unicellular organism with some plant and animal elements, it exists named a protist. Plant cells contain walls while algae don't contain one, so it exists as a protozoan. Algae reach the protozoa, so they stand to put into the Protist Kingdom.

To learn more about algae refer to:

https://brainly.com/question/1747534

#SPJ2

If a sample originally had 120 Adams of carbon 14 how many atoms will remain after 17,190 years

Answers

Answer:

15 atoms

Explanation:

About 15 atoms out of the 120 Adams would remain.

Generally, the half-life of a substance is the time it takes for one-half of that substance to disintegrate.

Carbon 14 has a half-life of approximately 5,730 years. 17,190 years means that the sample had stayed for 17,190/5,730 which is equal to 3 carbon-14 half-lives.

Out of 120 Adams,

the first half-life will reduce 120 to 60 Adamsthe second half-life will reduce 60 Adams to 30 Adamsthe third half-life will reduce 30 Adams to 15 Adams.

Hence, at the end of the 17,190 years, approximately 15 Adams would remain.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.


1. How is natural selection related to the process of evolution?

Answers

Answer:

Natural selection is related to the process of evolution because It is one of the processes that drives change and helps to clarify the diversity of life on Earth.

Explanation:

Hope that helps

What types of cells have cell walls ?

Answers

A cell wall is a fairly rigid layer surrounding a cell located outside of the plasma membrane that provides additional support and protection. They are found in bacteria, archaea, fungi, plants, and algae. Animals and most other protists have cell membranes without surrounding cell walls.

The type of cell that possess cell wall is plant cell. The correct option is A.

What is cell wall?

A cell wall is a structural layer located just exterior the cell membrane that surrounds certain types of cells.

It can be tough, flexible, along with being rigid at times. It basically aids structural support as well as protection to the cell, as well as acting as a filtering mechanism.

The cell wall is made up of a network of cellulose microfibrils and cross-linking glycans embedded in a matrix of pectin polysaccharides that is highly cross-linked. Lignin can be found in secondary cell walls.

Plant cell walls, as the interface between adjacent cells, frequently play important roles in intercellular communication.

Plant cell walls play an important role in plant-microbe interactions, including defense responses against potential pathogens, due to their surface location.

Thus, the correct option is A.

For more details regarding cell wall, visit:

https://brainly.com/question/965751

#SPJ2

Your question seems incomplete, the missing options are:

Plant cell.Muscle cells.Blood cells.Animal cells.

The following RNA strand was produced:

5′ AAA AUG AGU AAG 3′

Which of the following DNA strands could have been the template for this RNA?

Choose 1 answer:

(Choice A)
3′ AAA ATG AGT AAG 5′


(Choice B)
3′ UUU TAC UCA UUC 5′

(Choice C)
3′ TTT TAC TCA TTC 5′

(Choice D)
3′ TTT ATG TGC TTC 5′

Answers

Answer:

Choice 3

Explanation:

Because T corresponds with A and the letter could have been an option but the letter U cannot be in a DNA strand

Other Questions
The belief that Europeans are the superior class in society is called? Question 1 of 11What are two ways space exploration can improve international relations?DA By urging countries to compete to achieve goalsDB. By helping countries' economies grow weakerDC. By encouraging countries to share scientific dataDD. By inspiring countries to work together to solve problems explain the ides behind majority rule and minority rights 3. Study the changes in population graph, what % lived in cities by the 1930's?By the 1970's? What led the people of France to agree to an imperial dictatorship instead of a true democratic republic like the one selected in the American colonies? why human are not responsible for global warming? Which of the following cells can generate ATP through glycolysis? A. Eukaryotic Cells (Plants and Animals) B. Prokaryotic Cells (Bacteria) C. None of the above D. All of the above What is the length of EF in the right triangle below? Choose one of the three themes (social oppression, greed, or good vs. Evil) and explain something you know about it in the real world OR explain where else you have seen the theme (a book, movie, show, etc.) Please help quick What is f(2) if f(x) = 2x-5 and f(4) if f(x) = -3x + 15step by step please! Solve.Okay here is 20 letters brainy Please which one is the right answer Please help with this What is public participation? Why is itnecessary for environmental conservation AUUUAACUGUUCUGUCUAGAG1. Construct an Explanation Based only on the information provided, why could themRNA section be translated into three different sets of amino acids, instead of just oneset?2. Use Models Use the genetic code to translate the sequence into each of the threepossible sets of amino acids.3. Draw Conclusions Which of the three sets of amino acids is the most likely to beincluded in the polypeptide? Explain your reasoning. Please help me with this homework Different cities have different sales tax rates. Here are the sales tax charges on the same items in two different cities.Complete the tables. 50 points brainliest I'm watching to wait explain the difference between essential body fat and storage body fat which is true about the subject matter of an ode?a. it is usually a well-known object such as a monumentb. it varies greatly from famous people to ordinary objectsc. it is often something imaginary or mythicald. it tends to focus on an explored exotic places Find the amount of sales tax if the sales tax rate is 5% and the cost of the winter coat is $40. Hint: this question is only asking for the sales tax.