1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose?

Answers

Answer 1

When cloning by restriction digest and ligation, restriction enzymes are used to cut open a plasmid (backbone) and insert a linear piece of DNA (insert) cut by suitable restriction enzymes.

How do restriction enzymes of type 2 cleave DNA?

Type II restriction enzymes are the ones that are most commonly utilised in molecular biology applications including gene cloning and DNA fragmentation and analysis. These enzymes break DNA at certain places in relation to their recognition sequence, resulting in repeatable fragments and discrete gel electrophoresis patterns.

Traditional classifications of restriction enzymes are based on subunit composition, cleavage location, sequence specificity, and cofactor requirements.

learn more about electrophoresis patterns

https://brainly.com/question/13813089

#SPJ1


Related Questions

where may activators bind? select one: a. both of these regions b. the regulatory region near the promoter c. a distant enhancer region d. neither of these regions

Answers

The activators can bind to both the regulatory region near the promoter and a distant enhancer region, allowing them to regulate gene expression in various ways. Option (a) is correct answer.

Activators are proteins that play an essential role in the regulation of gene expression. They are capable of binding to specific regions of DNA, which can lead to the activation of transcription of nearby genes. The question at hand is where activators may bind.

The answer is that activators may bind to both the regulatory region near the promoter and a distant enhancer region. The regulatory region near the promoter is a DNA sequence located close to the promoter, which contains binding sites for activators and other transcription factors.

The enhancer region, on the other hand, is a DNA sequence located far away from the promoter, which can still influence gene expression through the binding of activators.When an activator binds to the regulatory region near the promoter,

it can directly interact with the transcription machinery and stimulate transcription of the nearby gene. When an activator binds to a distant enhancer region,

it can also interact with the transcription machinery indirectly by bringing the enhancer region closer to the promoter through DNA looping. This way, it can still influence the transcription of the nearby gene.

To learn more about : activators

https://brainly.com/question/30870646

#SPJ11

why does the human body need energy in forms other than heat?

Answers

In summary, while heat is a byproduct of energy consumption in the human body, the body requires energy in other forms to support vital life processes and maintain overall health.

The human body needs energy in forms other than heat for various essential functions. These functions include:
1. Cellular processes: Energy is required for cellular activities like cellular respiration, protein synthesis, and cell division. This energy is usually in the form of adenosine triphosphate (ATP).
2. Muscle movement: Physical activities such as walking, running, and lifting objects require energy to contract and relax muscles, enabling movement and strength.
3. Brain function: The human brain needs energy to perform cognitive tasks, including thinking, learning, memory, and decision-making. This energy helps maintain the proper function of neurons and neurotransmitter production.
4. Growth and repair: The body uses energy to build new tissues, repair damaged cells, and maintain organ function.
5. Metabolism: Energy is needed to fuel the chemical reactions that break down food, absorb nutrients, and eliminate waste

Learn more about energy here:

https://brainly.com/question/30512162

#SPJ11

Choose all that are correct regarding antimicrobial susceptibility test/Disk Diffusion method: A. Susceptility breakpoint is the zone diameter above which all susceptible strains of microbe fall. B. Bacteriostatic and bactericidal agents inhibit replication of microbes. C. Resistance breakpoint is the zone diameter below which all resistant strains of microbes fall D. The diameter of the zone of inhibition is inversely proportional to the susceptibility of the organism. E. At the minimum inhibitory concentration, the concentration of the antimicrobic is highest and growth of the organism effectively stopped.

Answers

The correct statements regarding antimicrobial susceptibility test/Disk Diffusion method are:

A. Susceptibility breakpoint is the zone diameter above which all susceptible strains of microbe fall.
C. Resistance breakpoint is the zone diameter below which all resistant strains of microbes fall.
D. The diameter of the zone of inhibition is inversely proportional to the susceptibility of the organism.

B and E are not correct statements as B talks about the inhibition of replication of microbes by both bacteriostatic and bactericidal agents, which is not true for both. Bacteriostatic agents only inhibit the growth of microbes while bactericidal agents kill the microbes. E talks about the minimum inhibitory concentration, which is the lowest concentration of antimicrobial agent that inhibits the growth of the organism, not the highest concentration.

Know more about antimicrobial susceptibility here:

https://brainly.com/question/31538863

#SPJ11

Explain all the steps of the path that a carbon atom takes in a plant starting from the atmospheric air and ending with a growing root hair cell.

Answers

The path that a carbon atom takes in a plant starting from the atmospheric air and ending with a growing root hair cell involves several steps. Here are the steps; Absorption of carbon dioxide: Plants absorb carbon dioxide from the atmosphere through tiny pores called stomata in the leaves.

Photosynthesis: Inside the leaf, the absorbed carbon dioxide combines with water to form glucose and oxygen molecules. This process is called photosynthesis and occurs in the chloroplasts of plant cells.

Translocation: Once glucose is produced, it is transported from the leaves to other parts of the plant through a process called translocation. This involves the movement of sugars through specialized tubes called phloem.

Respiration: In the growing root hair cell, the glucose is broken down into carbon dioxide and water in a process called respiration. This releases energy that the cell can use for growth and other metabolic processes.

Cell division and growth: The energy released from respiration drives the growth and division of the root hair cell. As the cell grows, it absorbs water and nutrients from the soil through its root hairs.

Conversion of glucose: The glucose produced during photosynthesis can also be stored as starch in the plant's cells, providing a long-term source of energy for the plant.

In summary, the carbon atom enters the plant as carbon dioxide through the stomata of the leaves. It is then converted into glucose through photosynthesis and transported to other parts of the plant through translocation. In the growing root hair cell, the glucose is broken down through respiration to provide energy for growth and other metabolic processes. The carbon atom is ultimately incorporated into the plant's tissues and can be used for long-term storage as starch.

To know more about Photosynthesis

brainly.com/question/29764662

#SPJ11

scientists recently proposed a reorganization of the phylogenetic system of classification to include the domain, a new taxonomic category higher ( more inclusive) than the kingdom category, as shown in the diagram below.
a. describe how this classification scheme presents different conclusions about the relationships among living organisms than those presented by the previous five kingdom system of classification
b. describe three kinds of evidence that were used to develop the taxonomic scheme above and explain how this evidence was used
c. describe four of the characteristics of the universal ancestor

Answers

A. Compared to the older five kingdom system, the domain classification system revises our knowledge of organismal relationships.

B. Comparative anatomy, molecular genetics, and phylogenetic analysis are examples of evidence used to support taxonomic classification.

C. The universal ancestor was prokaryotic, had a basic structure, probably reproduced asexually, and utilized an anaerobic metabolism.

Compared to the older five kingdom system, the inclusion of the domain category redefines the relationships between living things. There are important genetic and molecular differences between prokaryotes and eukaryotes, which are recognized by the domain category. Eukaryotes were given their own kingdom in the five-kingdom system, which meant they had a stronger bond than prokaryotes. The new approach provides a clearer understanding of the evolutionary tree by providing a more accurate representation of evolutionary distances and emphasizing the individuality of prokaryotes.

The taxonomic classification was developed in response to three different types of evidence. Structures were analyzed through comparative anatomy to reveal evolutionary relationships. DNA and protein sequences were analyzed by molecular genetics to identify genetic relatedness and divergence dates. Using morphological and genomic data, phylogenetic analysis built evolutionary trees, traced lineages, and classified species based on shared traits.

A primitive structure, possible asexual reproduction, anaerobic metabolism and a bacterial origin are characteristics of the universal ancestor. These discoveries shed light on early life traits and development.

Learn more about kingdom, here:

https://brainly.com/question/14688752

#SPJ12

Peas were a useful subject for Mendel's experiments because they have a number ofdichotomous traits.mating strategies.maladaptations.canalized behaviors.

Answers

Mendel used peas for his experiments because they exhibit dichotomous traits, which are characteristics that can be classified into one of two distinct categories. Peas were particularly well-suited for this type of research due to their easy cultivation, quick reproduction, and simple genetic makeup.

Peas were a useful subject for Mendel's experiments because they exhibit a number of dichotomous traits. Dichotomous traits refer to characteristics that can be classified into one of two distinct categories, such as tall or short, yellow or green, round or wrinkled. By observing the inheritance patterns of these traits in successive generations of pea plants, Mendel was able to establish the basic principles of genetics. Peas were particularly well-suited for this type of research because they are easy to grow, reproduce quickly, and have a relatively simple genetic makeup. This allowed Mendel to isolate and manipulate specific traits in order to study their patterns of inheritance. Overall, Mendel's experiments with pea plants laid the foundation for modern genetics and helped to establish the fundamental principles of heredity.

Know more about genetics here:
https://brainly.com/question/28980835
#SPJ11

I need help asap!!
What skull most resembles the Homo sapiens?

What evidence from the chart led you to that conclusion?

What hominid group does the mystery skull most resemble?

What evidence from the chart led you to that conclusion?

Answers

Among all the known hominid skulls, the skull of Homo sapiens most closely resembles the modern human skull.

What skull most resembles the Homo sapiens?

However, it's worth noting that there are some anatomical differences between the modern human skull and the skulls of our earlier hominid ancestors, such as a larger brain case and smaller brow ridges in modern humans. Additionally, there are also some regional variations in the human skull, such as differences between skulls of people from different geographic regions or ethnic groups.

Read more on Homo Sapiens here:https://brainly.com/question/5176769

#SPJ1

I need help with this please. It's really easy. ​

Answers

Answer:

here you go I hope this helps

Please select all of the correct statements concerning systemic lupus erythematosus (SLE) to test your understanding of the pathogenesis of autoimmune diseases.
(NOTE Please change a question marks to checkmarks for correct answers or empty boxes for incorrect answers).
Check All That Apply a. Autoantibodies bind set antigensforming immune complexes that accumulate in basement membranes of various organs b. SLE represents a type hypersensitivity reaction c. Autoantibodies made against DNA and other nuclear components in a variety of cells d. Results in an autoimmune disease that targets the thyroid e. Results in muscle weakness as its principle symptom

Answers

✓ a. Autoantibodies bind set antigens forming immune complexes that accumulate in  membranes of various organs ✓ c. Autoantibodies made against DNA and other nuclear components in a variety of cells

d. Results in an autoimmune disease that targets the thyroi  e. Results in muscle weakness as its principle symptom a. Autoantibodies produced in SLE can bind to self-antigens such as DNA and form immune complexes that can accumulate in various organs including the kidneys, joints, and skin,  leading to tissue damage and inflammation. b. SLE is not a type of hypersensitivity reaction, but it is classified as an autoimmune disease where the immune system mistakenly attacks the body's own tissues. c. Autoantibodies made against DNA and other nuclear components are a hallmark of SLE, and these autoantibodies can contribute to the formation of immune complexes and tissue damage. d. SLE does not typically target the thyroid. However, other autoimmune diseases such as Hashimoto's thyroiditis and Graves' disease can affect the thyroid gland. e. Muscle weakness is not a characteristic symptom of SLE, although some patients with SLE may experience muscle inflammation and pain as part of the disease.

Learn more about  DNA   here:

https://brainly.com/question/264225

#SPJ11

4. what do the different colors of the indicator tell you about the bacteria growing on the plate?

Answers

The different colors of the indicator on the plate can provide information about the population of bacteria growing on it. For example, if the indicator turns yellow, it may indicate the presence of acid-producing bacteria. If it turns blue, it may indicate the presence of alkaline-producing bacteria. This information can be useful in identifying the types of bacteria present and monitoring changes in the population over time.

To know more about bacteria, click here:-

https://brainly.com/question/8008968

#SPJ11

bnp is elevated in mark’s blood. what effect does bnp have on blood volume and pressure and how does it achieve this?

Answers

BNP helps to regulate blood volume and pressure by causing vasodilation, increasing natriuresis, and inhibiting the RAAS. In the case of Mark's elevated BNP levels, it may be an indication of heart failure .

In general , BNP  promotes natriuresis, which is the excretion of sodium and water in the urine. The hormone acts on the kidneys to increase the filtration rate and reduce the reabsorption of sodium and water, resulting in a reduction in blood volume and pressure. Also, BNP inhibits the RAAS at multiple points in the cascade, reducing the secretion of aldosterone and promoting natriuresis.

In cases where BNP levels are elevated, such as in Mark's case, it may indicate an underlying cardiovascular condition that is causing increased pressure and volume in the cardiac chambers, prompting the release of BNP as a compensatory mechanism.

To learn more about BNP levels , here

brainly.com/question/30764477

#SPJ4

Which of the following is/are used to classify a star based on its temperature in luminosity?

Parallax measurements

Hertzsprung Russell diagram

Blackbody spectrum

Line spectra

Answers

Answer:

Explanation:

The Hertzsprung Russell diagram is used to classify a star based on its temperature and luminosity. The other methods mentioned are important in studying stars, but not specifically for classification purposes in terms of temperature and luminosity.

what are the characteristics of a secondary antibody used in western blotting? recognizes the fc region of the primary antibody recognizes the fab region of the primary antibody contains a covalently attached tag recognizes antibodies from multiple species

Answers

The characteristics of a secondary antibody used in Western blotting include the ability to recognize the Fc region of the primary antibody, the ability to recognize antibodies from multiple species, and the presence of a covalently attached tag.

Secondary antibodies are used in Western blotting to detect primary antibodies, which are used to bind to the protein of interest on the blot. The secondary antibody recognizes and binds to the Fc region of the primary antibody, which allows for detection of the protein of interest. Additionally, secondary antibodies can be designed to recognize and bind to antibodies from multiple species, which can be useful in experiments where different primary antibodies from different species are used. Finally, secondary antibodies may contain a covalently attached tag, such as a fluorescent dye or enzyme, which can be used for visualization or quantification of the protein of interest.

In summary, secondary antibodies used in Western blotting should be able to recognize the Fc region of the primary antibody, recognize antibodies from multiple species, and may contain a covalently attached tag for visualization or quantification purposes.

Learn more about antibodies here:

https://brainly.com/question/27931383

#SPJ11


Drag each label to the correct location.
Sort the questions based on whether they are testable.
How do customers feel about
the services of airlines?
Do pollutants have a greater
effect on saltwater or
freshwater environments?
Do people who eat chocolate
have more acne?
Is it ethical to eat meat?


testable

not testable

Answers

Do pollutants have a greater effect on saltwater or freshwater environments?

What is environments?

An environment is the natural world and all of the living and non-living things that exist within it. It includes physical elements such as land, air, water, and climate, as well as biological factors such as plants, animals, and other organisms. The environment is constantly changing and interacting with humans, who are also part of it. Human activities such as clearing forests, burning fossil fuels, and polluting the air and water can have a significant impact on the environment. People must take steps to protect and restore the environment in order to ensure a healthy planet and future generations.

Is it ethical to eat meat?

not testable

How do customers feel about the services of airlines?

testable

Do people who eat chocolate have more acne?

To learn more about environments

https://brainly.com/question/935140

#SPJ1

true or false: the material for cellulose microfibrils is delivered to the extracellular matrix of plants by vesicle transport.

Answers

Answer:

Explanation:

False.because the major component of the extra celluar matrix is the protein .the major organic molecule of the plant cell wall is cellulose which assembles into fibers called the microfibrils

how is it that all life is connected by descent?

Answers

All life is connected by descent because it refers to the process through which organisms inherit traits from their ancestors.

All life on Earth is connected by descent because all living organisms share a common ancestor that existed billions of years ago. This common ancestor was the first organism to emerge on Earth and subsequently gave rise to all the diverse forms of life that exist today through a process of evolution.

All living organisms share a common ancestor, which is the starting point for the Tree of Life.Over time, the common ancestor diversified into various species through processes like mutation, natural selection, and genetic drift.These species further diversified, giving rise to new species, and the process continued through multiple generations.As a result, each species or organism can trace its lineage back to the common ancestor through a series of ancestral connections.This connection through descent shows how all life on Earth is related and interconnected.

In summary, the concept of descent helps us understand how all life is connected by demonstrating that every organism shares a common ancestry and inherits traits from their ancestors.

Learn more about evolution:

https://brainly.com/question/21202780

#SPJ11

All life is connected by descent because it refers to the process through which organisms inherit traits from their ancestors.

All life on Earth is connected by descent because all living organisms share a common ancestor that existed billions of years ago. This common ancestor was the first organism to emerge on Earth and subsequently gave rise to all the diverse forms of life that exist today through a process of evolution.

All living organisms share a common ancestor, which is the starting point for the Tree of Life.Over time, the common ancestor diversified into various species through processes like mutation, natural selection, and genetic drift.These species further diversified, giving rise to new species, and the process continued through multiple generations.As a result, each species or organism can trace its lineage back to the common ancestor through a series of ancestral connections.This connection through descent shows how all life on Earth is related and interconnected.

In summary, the concept of descent helps us understand how all life is connected by demonstrating that every organism shares a common ancestry and inherits traits from their ancestors.

Learn more about evolution:

https://brainly.com/question/21202780

#SPJ11

TABLE 19.5 Normal Values for ECG Periods Period Normal Value 60-100 beats per minute Heart rate 0.60-1.0s R-R interval 0.12-0.205 P-R interval 0.42-0.44s An electrocardiograph records the tracing at a standard speed of 25 mm/second. This allows us to determine precisely the heart rate and the duration of the intervals we discussed. As you can see in Figure 19.7, each small box on the ECG tracing measures 0.04s, and each large box measures 0.20s. Five large boxes together measure 1 second. Determining the duration of most intervals is simple-just count the small or large boxes, and add the seconds together. Calculating the heart rate is equally simple: count the number of large boxes, and divide 300 by this number. For example, if you count 4.2 boxes: 300/4.2 = 71 beats per minute. The normal values for the periods we discussed are given in Table 19.5. Q-T interval QRS complex duration Less than or equal to 0.125 Procedure 2 Interpreting an ECG Now that you understand what the wave forms on an ECG mean, you can perform some basic ECG interpre- tation. Following are two tracings for which you will calculate the heart rate and determine the duration of key intervals of the ECG. When you have completed the activity, answer Check Your Understanding question 6 (p. 528). 1 Identify and label the wave, QRS complex, T wave, PR interval, R-R interval, and Q-T interval on Tracings 1 and 2 in Figure 19.9. Tracing 1 Tracing 2 RGRE 19.9 ECG tracings 19 2 Calculate the heart rate for each tracing. Are the values normal or abnormal? Heart Rate Tracing 1: Heart Rate Tracing 2: 3 Determine the R-R interval, QRS duration, P-R interval, and Q-T interval for each TABLE 19.6 Values for ECG Periods tracing, and record the values in Table 19.6. Value Tracing 1 Tracing 2 R-R interval ORS duration P-R interval O-T interval Cardiovascular System-Part I: Cardiovascular Physiology UNIT 19 521

Answers

Hi! Based on the information provided, you are looking to analyze and interpret ECG tracings using the normal values for ECG periods listed in Table 19.5. Here's a brief guide to help you through this process:


1. First, identify and label the P wave, QRS complex, T wave, PR interval, R-R interval, and QT interval on the given ECG tracings.
2. To calculate the heart rate for each tracing, count the number of large boxes between two consecutive R waves, then divide 300 by this number. For example, if you count 4.2 boxes: 300/4.2 = 71 beats per minute. Compare your calculated heart rate to the normal value of 60-100 beats per minute to determine if it's normal or abnormal.
3. Determine the R-R interval, QRS duration, PR interval, and QT interval for each tracing. Use the small boxes (0.04s each) and large boxes (0.20s each) to measure the duration of these intervals. Record the values in Table 19.6 and compare them to the normal values provided in Table 19.5 to check for any abnormalities.
By following these steps, you'll be able to interpret the ECG tracings and identify any abnormalities in the heart rate and key intervals.

Learn more about ECG here:

https://brainly.com/question/29738201

#SPJ11

Bergey’s Manual of Systems Bacteriology provides information on classifying bacteria according to rRNA.
True
False

Answers

Bergey’s Manual of Systems Bacteriology provides information on classifying bacteria according to rRNA. This statement is true.


What is Bergey's manual of systematic bacteriology?
Bergey's Manual of Systematic Bacteriology is a reference work containing information on bacterial taxonomy, including classification based on rRNA sequencing. This manual is widely used in the field of bacteriology for identifying and classifying pathogenic and non-pathogenic bacteria. Gram staining, which is used to differentiate between gram-positive and gram-negative bacteria, is also an important tool in bacteriology.

Bergey's Manual is an important resource in bacteriology, which is the study of bacteria. It helps researchers and scientists classify and identify bacteria, including pathogens, which are disease-causing microorganisms. The manual also contains information on methods such as gram staining, a technique used to differentiate bacterial species into two groups (Gram-positive and Gram-negative) based on the characteristics of their cell walls.

To know more about classification of bacteria, visit:

https://brainly.com/question/30870028

#SPJ11

Ricin is a toxin found in castor beans that acts on ribosomes and blocks translation in eukaryotes. If the researchers added ricin to the sea urchins embryos, the researchers:

1. Would have blocked cell division

2. Would have seen decreasing levels of all proteins

3. Would not have seen increasing levels of all proteins

4. Would have observed cyclical levels of many different proteins

5. Would have seen the same results

Answers

1. Would have blocked cell division: Ricin acts on ribosomes and blocks protein synthesis.

What is ribosomes?

Ribosomes are cellular organelles composed of ribosomal proteins and ribosomal RNA. They are found throughout the cytoplasm of all eukaryotic cells and are the sites of protein synthesis. Ribosomes translate the genetic code from messenger RNA into proteins, which are essential for the cell to carry out its functions.

Without proteins, cells cannot divide, so cell division would be blocked.

2. Would have seen decreasing levels of all proteins: Ricin blocks protein synthesis, so the levels of proteins would decrease over time as proteins are not replaced.

3. Would not have seen increasing levels of all proteins: Ricin blocks protein synthesis, so the levels of proteins would not increase over time.

4. Would have observed cyclical levels of many different proteins: Ricin blocks protein synthesis, so the levels of proteins would decrease and then eventually plateau as the proteins are no longer replaced.

5. Would have seen the same results: Ricin affects all eukaryotic cells in a similar way, so the results would be the same.

To learn more about ribosomes

https://brainly.com/question/8773679

#SPJ1

a polysome consists of multiple _____________ bound to a single mrna. group of answer choices release factors ribosomes initiation factors polymerases trnas

Answers

A polysome is made up of several different ribosomes that are all linked to the same mRNA. A polysome is created when a number of ribosomes are linked together with a single mRNA.

The mRNA serves as a blueprint for the creation of proteins, but it is the ribosomes that are really responsible for translating the mRNA into proteins. In order to maximise the efficiency of protein synthesis, it is necessary to have polysomes, which allow many ribosomes to translate the same mRNA at the same time. As a consequence of this, translation is more efficient, and the rapid synthesis of a massive amount of protein is assured.

Learn more about polysome here:

https://brainly.com/question/28424314

#SPJ11

A polysome is made up of several different ribosomes that are all linked to the same mRNA. A polysome is created when a number of ribosomes are linked together with a single mRNA.

The mRNA serves as a blueprint for the creation of proteins, but it is the ribosomes that are really responsible for translating the mRNA into proteins. In order to maximise the efficiency of protein synthesis, it is necessary to have polysomes, which allow many ribosomes to translate the same mRNA at the same time. As a consequence of this, translation is more efficient, and the rapid synthesis of a massive amount of protein is assured.

Learn more about polysome here:

https://brainly.com/question/28424314

#SPJ11

During the post-natal period, human growth is not isometric – an adult is not a proportionally scaled up baby (left panel). Allometric growth of various body structures results in changes in their proportion relative to total height (or mass).
After measurements of two structures over the course of growth, an allometric (double logarithmic) plots relative to total height we made (right panel). The dashed line is an isometric line.
(a) What body parts might plot A and plots B represent?
(b) Why might the two lines have different slopes?
(c) How does the difference in the slope account for the differences in the growth trajectory
of the two structures?

Answers

(a) The plot A and plot B might represent different body parts such as head circumference and height (plot A) and body mass and height (plot B).

(b) The two lines might have different slopes because different body parts may have different growth rates during the post-natal period.

For example, the head may grow faster in the early stages of life, while the body may grow more slowly and then accelerate in growth during puberty. This can result in different allometric relationships between body structures and total height or mass.

(c) The difference in the slope of the two lines can account for the differences in the growth trajectory of the two structures.

A steeper slope indicates a higher growth rate relative to the growth of the whole body, while a shallower slope indicates a lower growth rate relative to the growth of the whole body.

For example, if the slope of the head circumference vs. height plot (plot A) is steeper than the slope of the body mass vs. height plot (plot B), it means that the head is growing faster relative to the body, which may result in changes in the overall proportion of the body over time. This can also explain why an adult is not a proportionally scaled up baby, as different body structures grow at different rates during the post-natal period.

learn more about body mass here:

https://brainly.com/question/14806759

#SPJ11

(a) The plot A and plot B might represent different body parts such as head circumference and height (plot A) and body mass and height (plot B).

(b) The two lines might have different slopes because different body parts may have different growth rates during the post-natal period.

For example, the head may grow faster in the early stages of life, while the body may grow more slowly and then accelerate in growth during puberty. This can result in different allometric relationships between body structures and total height or mass.

(c) The difference in the slope of the two lines can account for the differences in the growth trajectory of the two structures.

A steeper slope indicates a higher growth rate relative to the growth of the whole body, while a shallower slope indicates a lower growth rate relative to the growth of the whole body.

For example, if the slope of the head circumference vs. height plot (plot A) is steeper than the slope of the body mass vs. height plot (plot B), it means that the head is growing faster relative to the body, which may result in changes in the overall proportion of the body over time. This can also explain why an adult is not a proportionally scaled up baby, as different body structures grow at different rates during the post-natal period.

learn more about body mass here:

https://brainly.com/question/14806759

#SPJ11

Would you expect to see attenuation in the lacoperon and other operons that control the metabolism of sugars? Why or why not? Use your wild imagination, how would you set up the mutation study to support your answer? You must thoroughly explain your experimental setup for me to understand. If you search certain website or research article to answer this question, you have to in-text cite your reference.

Answers

Yes, we would expect to see attenuation in the lac operon and other operons that control the metabolism of sugars. Attenuation is a regulatory mechanism in prokaryotes where the translation of a leader peptide affects the transcription of downstream genes.

In the case of the lac operon, attenuation occurs when there is a high level of glucose in the environment. Glucose inhibits the production of cAMP, which is required for CAP to bind to the promoter region of the lac operon. Without CAP, the expression of the lac operon is reduced.

To set up a mutation study to support this idea, we could mutate the promoter region of the lac operon to remove the binding site for CAP. We would then compare the expression of the lac operon in wild-type and mutant strains in the presence and absence of glucose.

Learn more about  lac operon

https://brainly.com/question/29737281

#SPJ4

Explain two different types of evidence used to show that the Earth is warming.

Answers

Answer:

Hello the answer is in explanantion

Explanation:

Global temperature records: Over the past century, global temperature records show that the average temperature of the Earth's surface has increased by about 1 degree Celsius (1.8 degrees Fahrenheit). This may not sound like a lot, but it is a significant change in the context of the Earth's climate history.

Melting glaciers and ice caps: Glaciers and ice caps are melting at an unprecedented rate in many parts of the world. For example, the Greenland ice sheet, which is the second-largest ice sheet in the world, is losing an estimated 260 billion tons of ice per year. This melting has led to rising sea levels, which threaten to flood coastal communities and low-lying islands. The melting of glaciers and ice caps is also disrupting ecosystems and water supplies in many regions.

What are the similarities between pinocytosis and receptor-mediated endocytosis?

Answers

Both are types of endocytosis that involve the formation of vesicles to transport substances into the cell.

Pinocytosis and receptor-mediated endocytosis are both mechanisms by which cells take in substances from their external environment. In both processes, the cell membrane invaginates and forms a vesicle to enclose the extracellular material. Pinocytosis is a non-specific process that takes in small fluid droplets, while receptor-mediated endocytosis is more selective, involving the binding of specific molecules to receptor proteins on the cell membrane. Despite these differences, both processes play important roles in cellular uptake and recycling of materials, and ultimately contribute to the maintenance of cellular homeostasis.

learn more about endocytosis here:

https://brainly.com/question/14537096

#SPJ11

What is the the difference between the pseudopods of amoebozoans and the pseudopods of rhizarians (concept 28.3).?

Answers

The pseudopods of amoebozoans and rhizarians differ in their structure and function. Amoebozoans have broad, lobed pseudopods that are used for both movement and feeding.

These pseudopods are formed by the extension of the cytoplasm and are filled with organelles and food particles. In contrast, rhizarians have slender, thread-like pseudopods called filopodia that are used mainly for feeding.

These pseudopods are formed by the extension of microtubules and lack organelles.

Another difference between the two types of pseudopods is the way they move.

Amoebozoan pseudopods move by the assembly and disassembly of actin filaments, which allows for the extension and retraction of the pseudopod.

Rhizarian filopodia, on the other hand, move by the sliding of microtubules along each other, which allows for the extension and retraction of the pseudopod.

Overall, the differences in pseudopod structure and function reflect the different feeding and movement strategies employed by amoebozoans and rhizarians.

For more such answers on pseudopods

https://brainly.com/question/10221344

#SPJ11

The muscle that covers the bridge of the nose is the:
A) caninus muscle
B) buccinator
C) procerus
D) mentalis muscle

Answers

The muscle that covers the bridge of the nose is the C. procerus muscle. This muscle is a small, triangular muscle that extends from the lower part of the nasal bone to the skin between the eyebrows.

It helps to wrinkle the skin over the bridge of the nose, contributing to expressions of confusion, anger or concentration. The procerus muscle is also involved in reducing the appearance of horizontal wrinkles on the forehead by pulling the skin of the forehead downwards. Although it is a relatively small muscle, the procerus muscle plays an important role in facial expressions and overall facial aesthetics.

Learn more about nasal bone here:

https://brainly.com/question/31562457

#SPJ11

Order the events that occur in one cycle of the polymerase chain reaction (PCR). The reaction mixture contains four copiesof a particular DNA sequence. The reaction mixture contains eight copies of the DNA sequence.

Answers

In one cycle of the polymerase chain reaction (PCR), the following events occur Denaturing, annealing, and extension.


Events occurring in PCR:
1. Denaturation: The reaction mixture is heated to a high temperature (typically 94-96°C) to separate the double-stranded DNA into single strands.

2. Annealing: The temperature is lowered (typically to 50-65°C) to allow primers (short DNA sequences) to bind to the complementary sequences on the single-stranded DNA.

3. Extension: The temperature is raised again (usually to 72°C) to activate the heat-stable DNA polymerase enzyme. The polymerase adds nucleotides to the primers, synthesizing new DNA strands complementary to the original single-stranded DNA.

4. Completion: After the extension step, the cycle is finished. Now there are eight copies of the DNA sequence, as each of the original four copies has been duplicated.

These events repeat for multiple cycles to amplify the desired DNA sequence exponentially.

To know more about PCR amplification, visit:

https://brainly.com/question/30880827

#SPJ11

Susan has two boxes. Each is 12 cm high, 12 cm long,
and 12 cm wide. Which statement describes Susan's
boxes?
A) The boxes are congruent, but not similar.
B) The boxes are similar, but not congruent.
C) The boxes are similar and congruent.
D) The boxes are only similar.

Answers

Answer:

C

Explanation:

The dimensions of both boxes are the same which makes them congruent and similar. Congruent figures are always similar.

The answer is C) the boxes are similar and congruent.
Congruent figures are similar always

Sort the traits according to whether they suggest a living organism or nonliving object. Items (5 items) (Drag and drop into the appropriate area below) has photosynthetic cells that floatin the ocean contains only minerals contains no organic material has multicellular replicating cells contains only RNA, not DNA Categories Living Nonliving Drag and drop here Drag and drop here

Answers

Living traits - photosynthetic cells, multicellular replicating cells, and RNA-only; nonliving traits - minerals-only and no organic material.

Categorize traits as living or nonliving?

Photosynthetic cells that float in the ocean: Living

Contains only minerals: Nonliving

Contains no organic material: Nonliving

Has multicellular replicating cells: Living

Contains only RNA, not DNA: Living

Photosynthetic cells that float in the ocean: This trait suggests a living organism, specifically a type of algae or phytoplankton that perform photosynthesis and float in the ocean.Contains only minerals: This trait suggests a nonliving object, such as a rock or mineral sample.Contains no organic material: This trait also suggests a nonliving object, as organic materials are associated with living organisms and refer to compounds that contain carbon and hydrogen atoms.Has multicellular replicating cells: This trait suggests a living organism, specifically a type of multicellular organism that is capable of replicating or reproducing itself.Contains only RNA, not DNA: This trait also suggests a living organism, specifically a type of virus or RNA-based life form, as RNA is a nucleic acid that is associated with genetic material and is commonly found in living organisms.

Learn more about  Classification.

brainly.com/question/23863415

#SPJ11

what is the mechanistic basis for the observation that inhibitors of atp synthase lead to thee inhubition of etc

Answers

The mechanistic basis for the observation that inhibitors of ATP synthase lead to the inhibition of the electron transport chain (ETC).

ATP synthase is an enzyme that plays a crucial role in generating ATP (adenosine triphosphate) through a process called oxidative phosphorylation. This process occurs in the ETC, where electrons are transferred through a series of protein complexes to ultimately generate a proton gradient across the inner mitochondrial membrane. When inhibitors of ATP synthase are introduced, they block the enzyme's activity, preventing the conversion of ADP (adenosine diphosphate) to ATP. As a result, the proton gradient cannot be utilized to produce ATP, causing a buildup of protons in the intermembrane space. This buildup of protons leads to the inhibition of the ETC, as the proton gradient is essential for driving the electron flow through the chain. Consequently, the overall process of oxidative phosphorylation and cellular energy production is disrupted.

Learn more about electron here-

https://brainly.com/question/1255220

#SPJ11

Other Questions
What is the volume of the rectangular prism?A rectangular prism where the area of the base is 12 square centimeters and the height is 7 centimeters. 84 cm3 84 cm2 19 cm3 19 cm2 Is the below statement true or false? Explain.Assuming that all else remains constant, the length of a confidence interval for a population mean increases whenever the confidence level and sample size increase simultaneously. A block of mass M on a horizontal surface is connected to the end of a massless spring of springconstant k . The block is pulled a distance x from equilibrium and when released from rest, theblock moves toward equilibrium. What coefficient of kinetic friction between the surface and theblock would allow the block to return to equilibrium and stop? how many groups of ten questions con- tain four that require proof and six that do not? Solve for a. 38.5 58.5 a = [ ? ] Can someone help me interpret/analyze the meaning of the poem Chronic Town by Debra Allbery? how could you prove the substance you extracted was dna? let p(n) be the predicate "whenever 2n 1 players stand at distinct pairwise-distances and play arena dodgeball, there is always at least one survivor." prove this by induction 1 Element X is a radioactive isotope such that every 28 years, its mass decreases by half. Given that the initial mass of a sample of Element X is 50 grams, how much of the element would remain after 11 years, to the nearest whole number? Groupon is talked about in the media, discussed between friends, and featured in a textbook. These are examples ofMultiple Choiceword of mouth.public relations.marketing mix.publicity.B2B communication Some sources report that the weights of full-term newborn babies in a certain town have a mean of 7 pounds and a standard deviation of 0.6 pounds and are normally distributed. a. What is the probability that one newborn baby will have a weight within 0.6 pounds of the meaning dash that is, between 7.4 and 8.6 pounds, or within one standard deviation of the mean B. What is the probability that the average of four babies will be within 0.6 pounds of the mean; will be between 6.4 and 7.6 pounds? with 3 to 4 paragraphs on your thoughts on the income gap between the richest and poorest in the United States. Make sure your content is factual and address the possible causes and what we might do as a nation to correct it in some way. At least 2 sources - APA format. the gives government the authority to collect content records related to telephonic activities. What is pulsus bisferiens and what does it indicate? Why do you think Ulysses S. Grant treated the Confederate soldiers withrespect over time, housing shortages caused by rent control _____ because the supply of housing is _____ elastic in the long run. decrease; less increase; more decrease; more increase; less (a) find a vector parallel to the line of intersection of the planes 4x y 5z = 0 and x y z = 1. state the three integrity rules. indicate the reasons for enforcing each rule explain why external hash join is fast but uses memory very efficiently? In a right triangle, cos (62-x = sin (48 - 4.1x). Determine the value of x to the nearest tenth.A 90B 4C -4.4D 4.4