10. A Rock is a
type of rock that
forms from an
existing rock that is
changed by heat.

Answers

Answer 1

Answer:

yes

Explanation:

that is indeed the definition of a ROCK.

Answer 2
Yes that’s the definition and also the process of erosion

Related Questions

compare a frogs internal organs to a humans internal organs

Answers

Answer:

Answer is below

Explanation:

Frogs and humans share the same basic organs. Both have lungs, kidneys, a stomach, a heart, a brain, a liver, a spleen, a small intestine and a large intestine, a pancreas, a gall bladder, a urinary bladder and a ureter. ... On the whole, their organ structure is similar, but frogs have considerably less complex anatomies

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

An insulator the loss of heat energy.

slows down or speeds up

I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS

Answers

The heat slows down.

Answer: Slows down

Explanation: Insulation slows does the transfer of heat energy. think of it like this. a puffer jacket (more insulation) keeps you warmer longer than a t-shirt (less insulation).

:)

1. Why is cell an open dynamic system?​

Answers

The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

muscle cell labelled diagram ​

Answers

Explanation:

Here is a diagram, let me know if this is what you needed.

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?

Answers

Answer:

NO

EXPLANATION :

Aerobic cell respiration is roughly 18 times more efficient than anaerobic cell respiration. Your cells require a lot of energy and are dependent on the high efficiency of aerobic respiration. They quickly die if deprived of oxygen.

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

Which of the following characteristics are necessary for a fossil to be a good index fossil? (Choose all that apply)
had a broad geographic distribution
easy to identify at the species level
an invertebrate
short-lived

Answers

Answer:

A good index fossil is one with four characteristics: it is distinctive, widespread, abundant, and limited in geologic time. Because most fossil-bearing rocks formed in the ocean, the major index fossils are marine organisms.

Explanation:

Fossil to be a good index fossil are:-

Had a broad geographic distributionEasy to identify at the species levelAn invertebrateShort-lived

What is a fossil?Fossils are the preserved remains, or traces of remains, of ancient organisms. Fossils are not the remains of the organism.They are rocks. A fossil can preserve an entire organism or just part of one. Bones, shells, feathers, and leaves can all become fossils.

Hence, All the given option are correct.

To know more about fossils here

https://brainly.com/question/6867325

#SPJ2

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow​

Answers

Question:

Why animals reproduce?

Answer;

(A) To become many

why?

because if no animals in the world you will not enjoy of your childhood

that is my answer I hope it helps to you

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

Other Questions
What role did New World exports play in the Triangular Trade?African slaves were sent to Europe in exchange for goods like sugar, tobacco and cotton.Textiles, rum and other manufactured goods were sent to Africa in exchange for slaves.Tobacco was used to lure Africans to the Americas where they would be enslaved.Organic goods like tobacco were sent back to the specific colony's mother country. Mario ___ a la musics de Kanye west A. EscuchaB. EscuchoC. EscuchasD. Escuchan (-14,-3) (6,10) find the slope and explain please A line passes through (-3, -2) and is perpendicular to 3x - 2y = 7.What is theFind the image of A(6, -4) after it is reflected over the line y = - 2, then reflected over the line x = 1.(-4, -4)(-4, 0)(6, 2)(-4, 6) There is only one way to achieve behavior modification. Please select the best answer from the choices provided T F. simplify as much as possible please u get 50 points thank you Problem 1: Solution to the system of equationsA line is parallel to the line for the equation: -9y = 2x + 35.What is the slope of the parallel line? Find the value of aIm decided go between 40 and 6.4 (03.02) If g(x) = x2 + 2, find g(3). (2 points) Group of answer choices 9 8 11 6 What does Hola querida como estas (feminine)Hola querido como estas (masculine) mean? 8-kg lead brick falls from a height of 1.6 m.(a) Find its momentum as it reaches the ground.Ikg-m/s(b) What Impulse is needed to bring the brick to rest?N-s(c) The brick falls onto a carpet, 2.0 cm thick. Assuming the force stopping it is constant, find the average force the carpet exerts on the brickN(d) If the brick falls onto a 6,0 cm foam rubber pad, what constant force is needed to bring it to rest? Which type of reinforcement schedule results in the quickest learning 1/4 of 90. ???? A student earned 80% on a math test if she got 20 questions correct how many problems were on the test What is a central theme of Racing to Race?Training takes time and dedication.A close friend is good medicine.Good things always come to those who wait.Running a race is not always about winning.Question 2Part BWhich statement best shows how the theme identified in Part A is developed in the story?Carlo pictures himself winning a big race on the school track team and when he realizes that he may not be able to run, he is very discouraged and disappointed.Carlo realizes that he may not be able to compete on the school track team because his injury is not fully healed but discovers that he can still run for fun with his friend.Meiya reminds Carlo that he has just finished rehab, and Carlo acknowledges that he will once again have to build up his strength and endurance.Meiya knows that she is faster than Carlo, so she does her best to encourage him and also lets him win a race between them to boost his spirits. ribosomes contain three discrete sites where trnas bind and the polypeptide is synthesized. these are called site (a site), site (p site), and site (e site). Which of the following is a TCS food?Cooked potatoUncooked pastaCanned soupFlour Find the area of the shape. Can contact with mucous membranes blood borne pathogen be transmitted Can you simplify these two? 5 points for each.