Which structure is correctly described as exhibiting bilateral symmetry
O fingers that are distal to the arm
O an eye on each side of the sagittal plane
O a bely button along the medial area of the body
O the head in the upper portion of the transverse plane
The main idea behind Maslow’s hierarchy of needs is that
the most important needs must be met before the less important human needs can be met.
all needs are equally important and must be met simultaneously to achieve full health and success.
there are a few less important needs that must be met before the many important needs can be met.
all needs are equally important and their ability to be met can vary in timing.
Answer:
It is A!!!!
Explanation:
Project: Strategies for Effective Communication
In the lesson, there is a chart of strategies for effective communication. You will use this chart to complete your assignment. Select eight of the strategies. For four of the strategies, describe a situation where a team member models effective communication. For the other four strategies, describe a situation where a team member exhibits a breakdown in communication. Each scenario must be at least one paragraph in length.
For example: If the strategy was to always greet a patient in a positive and friendly way, we could describe a situation where a health care worker modeled this behavior or a situation where a health care worker did not act appropriately.
After you complete your scenarios, do some research online or in the library. Find at least two more strategies for effective communication. Provide an example of ineffective communication and effective communication related to each strategy. Discuss why you selected each strategy and how you think each strategy can be useful in effective communication. Make sure that you select strategies that were not mentioned in the chart or used as an example in the lesson.
Answer:
Focus on the issue, not the person. ...
Be genuine rather than manipulative. ...
Empathize rather than remain detached. ...
Be flexible towards others. ...
Value yourself and your own experiences. ...
Use affirming responses.
Meet regularly. Hold regular strategy meetings for the entire team. ...
Be inclusive. ...
Be transparent, clear and concise. ...
Show some respect. ...
Recognize that being right may be wrong. ...
Use online collaboration tools.
Explanation:
''.''
Complete the sentence to describe a procedure for food animals. Bulls are to improve the quality of beef, and to make the animals easier to manage.
Answer:
Castrated
Explanation:
Castration of bulls: Bulls or male calves are castrated to improve the quality of beef. This procedure also makes the animals less aggressive towards the rest of the herd.
Use the drop-down menus to select the best
answers.
Some myocardial infarctions involve erratic heart
behavior, such as
1.creating more carbon dioxide.
2.missing beats.
3.producing more oxygen.
4.pumping more blood.
PLEASE HURRY
Answer:
Explanation:
the second part is cardiac arrest
NAME THIS SONG AND ARTIST
Karma police
Arrest this man
He talks in maths
He buzzes like a fridge
He's like a detuned radio
Karma police
Arrest this girl
Her Hitler hairdo
Is making me feel ill
And we have crashed her party
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
Karma police
I've given all I can
It's not enough
I've given all I can
But we're still on the payroll
This is what you'll get
This is what you'll get
This is what you'll get
When you mess with us
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
For a minute there
I lost myself, I lost myself
Phew, for a minute there
I lost myself, I lost myself
why are technical schools established?
how do I make a homemade bandaid
Answer:
Put a paper Towel down and tape it
Explanation:
MEDICAL TERMINOLOGY!!
Use the restriction enzyme EcoRi to cut DNAVictim DNA :
GGAAG ATTCTACATTACTGACGGACGTGACGTGA
CCTTCTTAA GATGTAATGACTGCCTGCACTGACT
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
Suspect 1 DNA :
GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAA
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
Suspect 2 DNA :
CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGG
GGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCC
Number of restriction fragments ( pieces of DNA after digestion) :
Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :
PLEASE HELPPP!!!!
I WOULD APPRECIATE A LOT :)
Answer:
i put an answer but someone deleted it
Explanation:
Size-wise, your heart occupies about_____ of the space in your upper chest.
A. 1/10th
B. 1/4th
C. 1/2
D. 1.20th
Answer:b
Explanation:
Size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.
What is heart?Heart is defined as an organ that pumps blood throughout your body and is around the size of your fist. It is composed of numerous tissue layers. The core of your circulatory system is your heart. The heart is an important organ. It is a muscle that helps your body's blood flow throughout. The blood that your heart pumps provides your body with the oxygen and nutrition it needs to function.
The human heart is located in the mediastinum, which is a portion of the thoracic cavity located medially between the lungs. Low oxygen blood is taken from the body and pushed through the right atrium to the right ventricle. The blood with less oxygen is sent to the lungs via the right ventricle. Blood that is rich in oxygen is drawn from the lungs and pumped to the left ventricle by the left atrium.
Thus, size-wise, your heart occupies about 1/4th of the space in your upper chest. Hence option B is correct.
To learn more about heart, refer to the link below:
https://brainly.com/question/16566688
#SPJ2
Solve: -3x+1<-5
X>
X> 2
4
x<-2
What is the healthy percentage of body fat for men?
Answer:
The answer would be 18-24%.
Explanation:
How do blood types react in a transfusión ?
Answer:
person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.
Explanation:
person with type A blood receiving a transfusion of type B or AB blood would have an ABO incompatibility reaction. In an ABO incompatibility reaction, your immune system attacks the new blood cells and destroys them. If you have type AB blood, you have both A and B antigens.
Which represents the order of increasing educational levels?
professional –assistant-technologist-technician
technologist –assistant-professional-technician
technician –professional-technologist-assistant
assistant –technician-technologist-professional
What is the cause of the Carona Virus?
Or is the cause unknown.
Answer:
Hi. Im just taking these points.
Explanation:
What is the function of the serous membrane? (Be specific about what types of body cavities)
Answer:
Serous membranes line and enclose several body cavities, known as serous cavities, where they secrete a lubricating fluid which reduces friction from muscle movement. Serosa is entirely different from the adventitia, a connective tissue layer which binds together structures rather than reducing friction between them.
Explanation:
BRAINLIEST PLZZZZZZ
HELP PLEASE
Which would bring out the details in a tire track in mud?
A)casting an impression with dental stone
B)burning magnesium ribbon
C)casting an impression with putty
D)photography with direct lighting
The correct option is D) photography with direct lighting because it clearly shows the path and details of the tiretrack.
Tire marks can be seen on snow, mud, soil, sand, and even victims of crime scenes. These traces can be collected by photographing, pouring, lifting, and collecting the victim's clothing.
What is evidence of the pattern?
Tire marks are classified as evidence of the pattern, as tire marks leave a unique pattern. Just as shoe marks help narrow down brands, styles and sizes so can tire trucks.
Thus it clearly concludes that photography with direct lighting can collect great evidence.
To know more about tire track evidence refer to the link :
https://brainly.com/question/13397634