243 to the 1/5 power​

Answers

Answer 1

Answer:

-3

Step-by-step explanation:

Answer 2
Hopes this helps:

Answer: 3

How I know I use this app called Cymath.

Related Questions

(please answer if you know) On a​ map, 1 inch equals 5.2 miles. Two houses are 3.5 inches apart on the map. What is the actual distance between the​ houses? Use pencil and paper. Show how you can represent the scale with two different ratios. What ratio is more helpful for solving the​ problem? Explain.

Answers

18.2 is the answer . work = (5.2/2)+5.2(3)

85% of x is 51. Write an equation that represents the situation.

Answers

Answer:

85/100*x=51

Step-by-step explanation:

85x=5100

what is the slope of 4x-3y=18

Answers

Answer:

Look below

Step-by-step explanation:

[tex]4x-3y=18\\-3y=18-4x\\y=4/3x-6[/tex]

Answer:

Slope: 4/3

y-intercept: -6

I will give Brainliest answer!

What is the volume of the cylinder below? write your answer in terms of pie.

Height= 11.5 cm
Radius= 6 cm

Answers

Answer:

414π

Step-by-step explanation:

Volume of a cylinder = area of circle/ cross-section x height

Area of cross-section = πr² = 6²π = 36π

36π x 11.5 = 414π

Answer:

1300.61936 cm

Step-by-step explanation:

:))

A box of donuts cost $9. You want to send donuts to the local nursing home. Set up an equation to find how many boxes you can send if you have $72.

Answers

Answer:

8 boxes of donuts

Step-by-step explanation:

72$ /9$ = 8 boxes of donuts

help with math!!
Find the volume of each right rectangular prism

Answers

Answer:

7: 7.75   8: 6.98

Step-by-step explanation:

if 40% percent is a number of 35 what is 50% of that number

Answers

Answer:

what is 50% of 35?

Answer is 17.5.

Step-by-step explanation:

Select the most accurate statement regarding the normal distribution. Group of answer choices It is always the appropriate distribution in simulation modeling. It does not permit negative values. There is a 95% chance that values will be within ±2 standard deviations of the mean. The user must specify the maximum positive value allowed. It is obtained by the positive and negative square roots of a uniform random variable.

Answers

Answer:

There is a 95% chance that values will be within ±2 standard deviations of the mean.

Step-by-step explanation:

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

The Empirical Rule states that, for a normally distributed random variable:

Approximately 68% of the measures are within 1 standard deviation of the mean.

Approximately 95% of the measures are within 2 standard deviations of the mean.

Approximately 99.7% of the measures are within 3 standard deviations of the mean.

In this question:

According to the empirical rule, 95% of the measures are within 2 standard deviations of the mean. So the correct statement is:

There is a 95% chance that values will be within ±2 standard deviations of the mean.

help please it needs to be don by 4:00​

Answers

1: x=1
2: (1,-4)
3: min
4: -3
5: -1 and 3
6: all real numbers
7: y>or equal to -4
8: x=2
9: (2,-1)
13: c=121

those are all i can do for now hope they help

PLEASE HELPP!!!!

Please find the areas of these shape

Answers

The answer of the First one is 76

The length of one rectangle is 3 1/2 mm with a width of 2 4/5 mm . What is the area of the rectangle?

Answers

Answer:

9.8

Step-by-step explanation:

What is the answer please help no links I will report

Answers

Answer:

6

Step-by-step explanation:

because its the middle number

Find the area of the equilateral triangle to the nearest hundredth, given the radius.

Answers

9514 1404 393

Answer:

  20.78 square units

Step-by-step explanation:

The area of a regular polygon of radius r and number of sides n is given by ...

  A = (n/2)r²sin(360°/n)

For this regular 3-gon of radius 4, the area is ...

  A = (3/2)(4²)sin(360°/3) = 24(√3/2) = 12√3 . . . square units

The area is about 20.78 square units.

A class consists of 1/2 freshmen, 1/8 sophomores, and 1/8 juniors; the rest are seniors. What fraction of the class is seniors?

Answers

Answer:

2/8 are seniors

Step-by-step explanation:

one half = 4/8

4/8 + 1/8 + 1/8 = 6/8.

What's left is 2/8

What is the correct equation for this phrase?
Nine less than twice a number.

Answers

Answer:

[tex]2k - 9[/tex]

Step-by-step explanation:

jsjsjsjsjjsjsksksksksksksksksksjskkwjwjwjwkw

The sales rate is 8%. If Janelle buys a gymnastics mat priced at $87 , how much tax will she pay?

Answers

Answer: $6.96

Step-by-step explanation:

To find out what 8% of $87 is, you have to convert the 8% into decimal form which is 0.08. Then you have to multiply  that by $87

87*0.08 = 6.96

Now, we know $6.96 is 8% of $87 which is how much she will be paying in tax

Pricilla makes a profit of $24.50 on every scarf she sells the materials for each scarf cost
$8.39 how much does Priscilla sell each scarf for?

Answers

32.89 should be the answer if I’m reading your question right

⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️⚠️HELP HELP HELP HELP - A triangle has side lengths of 7, 23, and 25. Is the triangle a right triangle? *
Yes, the triangle is a right triangle.
No, the triangle is not a right triangle.
There is not enough information to tell if the triangle is a right triangle.

Answers

Answer:

No, the triangle is not a right triangle

Step-by-step explanation:

Answer:

To determine if the triangle is a right triangle, we can use the Pythagorean theorem, which states that in a right triangle, the square of the length of the hypotenuse (the side opposite the right angle) is equal to the sum of the squares of the other two sides.

Let's check if the given triangle satisfies the Pythagorean theorem:

7^2 + 23^2 = 49 + 529 = 578

25^2 = 625

Since 578 is not equal to 625, the triangle does not satisfy the Pythagorean theorem. Therefore, the triangle is not a right triangle.

PLEASE MARK AS BRAINLIEST

PLEASE HELP !! ILL GIVE BRAINLIEST !! 100 POINTS

Answers

Answer:

D) ONK and MNK

Step-by-step explanation:

All the other choices are either corresponding or vertical angles

guys someon about to comit u know what so go to this link and help out
https://brainly.com/question/22760250

Answers

Answer:

Is this called

BRAINLIEST WHO EVER ANSWERS FIRST !!!!!!I need someone to talk too! Please if anyone is willing to talk to me, I will give brainiest!

Answer:

A tropism (from Greek τρόπος, tropos, "a turning") is a biological phenomenon, indicating growth or turning movement of a biological organism, usually a plant, in response to an environmental sti

1. Write an integer that can
represent 200 years ago?


Answers

200 ??

200 is an integer

or 20

or 2

WILL MARK BRAINLY FOR WHO EVER GETS THIS RIGHT

Answers

Answer:

The first option and the third option

Step-by-step explanation:

Since the figure moved 4 places down and 4 places to the right.

Answer:

Option 1, ,2, 3, and 4 are correct.

Step-by-step explanation:

Have a nice day!

4. Are the expressions 3(y + 1) and 3y + 3, equivalent for y = 1? y= 2? y 3?​

Answers

Answer:

yes they both equal 1

Step-by-step explanation:

Pleaseee helppp me on this

Answers

Answer:

(-7,-13) (-6,-12) (3,-3) (5,-1) (7,1)

Step-by-step explanation:

plug in each x value into the equation

take -7 for example

when -7 is x, we plug it into the equation

[tex]y=x-6[/tex]

[tex]y = (-7) -6[/tex]

[tex]y=-13[/tex]

you would do this same process for the rest of the x values.

HELP (for the first select answer its “yes” or “no”)

Answers

Answer:

No, the sample is too small compared to the size of the shipment.

Step-by-step explanation:

There are 400 thousand people living in Miami and 300 thousand people living in Anchorage. Which statement below shows which city has more people living in it? - 400 thousand people > 300 thousand people, so there are more people living in Miami. 400 thousand people < 300 thousand people, so there are more people living in Miami. 400 thousand people > 300 thousand people, so there are more people living in Anchorage. 400 thousand people < 300 thousand people, so there are more people living in Anchorage.​

Answers

Answer:

Your answer is A <3

Step-by-step explanation:

Answer:

400 thousand people > 300 thousand people, so there are more people living in Miami.

At a school carnival, 51 out of 68 tickets sold were early-admission tickets. What percentage of the tickets were early-admission tickets?

Answers

Answer:

75% of the tickets sold were early-admission

Simplily divide 51/68

A walking path 78 mile long Colleen planted 14 bushes the same distance apart along the path how far power are the 1st 2 bushes along the path​

Answers

Answer:

The bushes will be located 6 meters apart from each other.

Step-by-step explanation:

Given that at a walking path 78 mile long Colleen planted 14 bushes the same distance apart along the path, to determine how far away are the 1st 2 bushes along the path, the following calculation must be performed:

78/13 = X

6 = X

Thus, since the first bush is at meter 0, the remaining 13 bushes will be located 6 meters apart.

BRAINLIEST!!! find the probability for numbers 11 and 13 please

Answers

Answer: probability of 11 = 5.56% probability of 13 = 52

Step-by-step explanation:

This angle cuts out 1/4 of the circle. Find the measure of the angle.

Answers

Answer:

90 degrees

Step-by-step explanation:

Other Questions
Pools are not selling well at Jays Store. So, he decides to put them on clearance for $19.99, plus an extra 20% off. Approximately how much will the small pool cost? Give me a brief summary of the middle age era of music? Find the mussing numbers13315+ ****24 305 Matt decides the length of his table will be 15 in. He calculates that the area of the table is 30 in. squared. Determine if Matts calculation is correct what do ducks short necks help them to do? pls help :/ A piece of fabric 4 meters long is cut into two pieces. One piece is 1.25 meters long. How much longer is the second piece of fabric? How do religious and ethnic groups both reflect and influence the geography of places at differentscales? You must use a number line!n + 5 > 13PLZ HELP ILL PUT BRAINLIEST What is the measure of arc QSR? Use the drop-down menus to complete these sentences.The running of a set of programming instructions multiple times is called .If a sequence of code is repeated multiple times, it is referred to as .One set of coding instructions processing many different sets of data and eliminating multiple lines of code is an example of An item on sale costs %50 of the original price. The original price was 45$.Find the sale price.Please help! I will give the brainiest! 9.5/19=x/30 solve the proportion Where are Gold, Limestone and kaiolin found. PLEASE HELP NO LINKS IM TIMED 1/2 x 1 3/5 to the simplest form Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG Match the words in the left column to the appropriate blanks in the sentences on the right. The secondary structure given in the MaxExpect results can best be described as_________ Thus, the type of RNA is best classified as_________ a single strand with a distinctive cloverleaf structure a single-stranded random coll an unspecified type of RNA rRNA a single strand folded upon itself to form a small, round structure tRNA Find the verbal in the sentence below. Then, Identify the type of verbal.Jane wanted to forget about the matter.-infinitive-participle-gerund Which choice is similar to the figure shown?Please help Im confused on what to do. A physics student of mass 43.0 kg is standing at the edge of the flat roof of a building, 12.0 m above the sidewalk. An unfriendly dog is running across the roof toward her. Next to her is a large wheel mounted on a horizontal axle at its center. The wheel, used to lift objects from the ground to the roof, has a light crank attached to it and a light rope wrapped around it; the free end of the rope hangs over the edge of the roof. The student radius 0.300 m and a moment of inertia of 9.60 kg m^2 for rotation about the axle, how long does it take her to reach the side walk, and how fast will she be moving just beofre she lands? a wave travels one complete cycle in20sec and has wavelength of 1000mm.what is the speed