4. Red-green colorblindness is inherited as a sex-linked recessive. If a colorblind
woman marries a man with normal vision, what would be the expected
phenotypes of their children?

Answers

Answer 1

The children would be 50% colorblind.

What is colorblindness?

Colorblindness refers to the inability to see colors in a normal way. Colors like blue, green, red, etc. in some very rare cases, a person cannot see any color at all. Colorblindness is also referred as Daltonism, named after its founder- john Dalton.

Types:

Monochromacy: 2-3 cone pigments are absent or damaged (red, green, blue). This leads to complete colorblindness.

Dichromacy: only one cone pigment is absent/ damaged (red, green, blue). This leads to partial colorblindness.

Color blindness is mostly a sex-linked recessive disorder. If a colorblind woman married a man with normal vision, the children would be fifty percent colorblind.

Learn more about colorblindness here: https://brainly.com/question/14282255

#SPJ1


Related Questions

31. Use the diagram to answer the question below.
What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w
(1 point)
30/100
Earth's albedo
30% reflected
and scattered
Earth's surface
Atmosphere
Clouds
Incoming
solar radiation
100 units
Drect
and
diffuse
51 absorbed at surface
Top of atmosphere
19 absorbed
by atmosphere
and clouds
O More solar radiation would be absorbed at the surface
O More solar radiation would be reflected and scattered
O More solar radiation would be absorbed by the clouds
O More solar radiation would reach Earth's atmosphere

Answers

More solar radiation would be reflected and scattered and More solar radiation would be absorbed by the clouds to the solar energy that reaches Earth's atmosphere.

A variety of methods, including solar power to produce electricity, solar thermal energy (including solar water heating), and solar architecture, are used to capture the radiant light and heat from the Sun.

It is a crucial source of renewable energy, and depending on how solar energy is captured, distributed, or transformed into solar power, its technologies can be roughly categorised as either passive solar or active solar.

Utilizing concentrated solar power, photovoltaic systems, and solar water heating are examples of active solar approaches. Passive solar strategies include aligning a structure with the Sun, choosing components with favourable thermal mass or light-dispersing qualities, and creating air-circulated areas.

To know more about Solar radiation visit:

https://brainly.com/question/12509139

#SPJ1

a recessive trait will be observed in individuals that are ________ for that trait.

Answers

Answer:

.

Explanation:

.

Answer:

A recessive trait will be observed in individuals that are homozygous for that trait.

Explanation:

Recessive traits will be observed only when the individuals are homozygous for that trait because for a recessive phenotype to appear in an indivual, there should be two recessive alleles (homozygous) otherwise dominant alleles in heterozygous will show dominant traits.

You wish to investigate how exercise affects the rate of cellular respiration. You decide to squeeze a ball for 5 minutes and around 3 minutes you begin to experience a burning sensation and fatigue. This means your muscles are beginning to run out of oxygen. What process is causing the burning in your muscles?




You wish to investigate how exercise affects the rate of cellular respiration. You decide to squeeze a ball for 5 minutes and around 3 minutes you begin to experience a burning sensation and fatigue. This means your muscles are beginning to run out of oxygen. What process is causing the burning in your muscles?




Electron transport chain


Alcoholic fermentation


Lactic acid fermentation


Krebs cycle

Answers

During muscle contraction, if feeling fatigued it means that muscles do not get in the required oxygen to generate ATP causing lactic acid fermentation, hence option c is correct.

What is Lactic acid fermentation?

A metabolic process called lactic acid fermentation turns six-carbon sugars like glucose or other six-carbon sugar disaccharides like sucrose or lactose into the metabolite lactate.

It generates carbon dioxide as well as lactic and acetic acids, which swiftly reduce pH levels and prevent the growth of bacteria that may otherwise ruin crispness.

Therefore due to anaerobic conditions muscle gate fatigue creates lactic acid fermentation, hence option c is correct.

Learn more about fermentation, here:

https://brainly.com/question/29404976

#SPJ1

why improving Microsoft Access
is important in the workplace?

Answers

This is not a bio question

What’s the correct answer answer asap for brainlist

Answers

Answer:

C.

so that u don't have to replicate the experiment

It’s B. A detailed method allows for reproducibility and repeatability

which process produce the gaseous by-product oxygen?

Answers

Oxygen is the gaseous by product released in the photosynthesis process.

The two essential biological processes that take place in plants are photosynthesis and respiration. The two processes that have been explored in the question are photosynthesis and respiration. Carbon dioxide is fixed to produce glucose and oxygen is liberated during photosynthesis.

Photosynthesis chemical equation:

6CO 2→12H 2O→C 6 H 12 O 6 +6H 2O+6O 2​

The oxygen from this reaction is fixed for respiration and glucose is broken down for the release of energy.

Respiration chemical equation:

C 6 H 12​O 6+6O 2 →6CO 2​ +6H 2

O+Energy↑

Oxygen released during photosynthesis will be used in respiration.

To know more about photosynthesis visit:
https://brainly.com/question/1388366
#SPJ9

Spartina is a plant that grows in salt marshes. It stores salt in its roots, making the root have a higher salt concentration than the water around them. What is most likely to occur in response to this concentration of salt in the roots?

A. Water moves out of the leave into the air

B. Nutrients move out of the roots

C. Salt moves into the roots

D. The plants are not in homeostasis so they die

F. Water moves into the roots

Answers

Spartina is a plant that grows in salt marshes. It stores salt in its roots, making the root have a higher salt concentration than the water around them.  Water moves into the roots is most likely to occur in response to this concentration of salt in the roots.

The grass family taxon Spartina is typically seen in coastal salt marshes.  One or two species also occur on the western coast of North America and in freshwater habitats inland in the Americas. Its species, also known as cordgrass or cord-grass, are native to the coasts of the Atlantic Ocean in western and southern Europe, north-western and southern Africa, the Americas, and the islands of the southern Atlantic Ocean. The east coasts of North and South America, notably Florida, have the greatest species variety. Particularly in coastal salt marshes, they establish sizable, frequently dense colonies and expand swiftly. The species' height ranges from 0.3-2 m. Several of the species will create hybrids if they interbreed.

The propensity of Spartina species to hybridize is widely documented. Late in the eighteenth century, S. Southern England unintentionally received alterniflora from North America. It quickly bred with the only local species, S, here. maritima produced a sterile but robust hybrid known as Spartina X townsendii that had the ability to propagate vegetatively (as can all Spartina species). This hybrid eventually underwent chromosomal duplication, becoming fertile. Although Spartina townsendii var. anglica is the preferred name for this species, it is also referred to as S occasionally. anglica, which is now the predominant Spartina species in the majority of salt marshes in the United Kingdom.

For more information about Spartina -https://brainly.com/question/18431680


3. Show the possible genotypes and phenotypes of the offspring from between a homozygous male with type A blood and a homozygous female with type B blood.

Answers

Answer:

A heterozygous male with type A blood IA IO

A heterozygous female with type B blood - IB IO

a cross between a heterozygous male with type A blood and a heterozygous female with type B blood.

Possible parent genotype: IA IO      x       IB IO

                                             AO     X      BO

possible offspring genotype: AB  AO  BO  OO

phenotypes: AB blood type (25%), A blood type (25%), B blood type (25%) and O blood type (25%).

Explanation:

The evidence that stimulated Newton to propose the law of universal gravitation emerged from a study of

a. the motion of the moon and other celestial or heavenly bodies

b. the fall of an apple to the Earth

c. the gravitational interaction of smaller objects upon the Earth

d. ...nonsense! There was no evidence; it was just proposed as a theory.

Answers

Explanation:

b. the fall of an apple to the Earth

A certain type of specialized cell contains an unusually large amount of rough endoplasmic reticulum (ER).

Which of the following functions is this cell type most likely specialized to perform?
a. The production and secretion of steroids
b. The destruction of toxic materials produced in other cells of the organism
c. The synthesis of polysaccharides for energy storage
d . The production and secretion of proteins

Answers

Cells that produce and secrete proteins have exceptionally high levels of rough endoplasmic reticulum (RER). The correct option to this question is D.

The endomembrane system, the plasma membrane, or proteins that will be secreted are the general purposes of the ER. All of the cell's membranes, including those of the endoplasmic reticulum, the Golgi apparatus, lysosomes, and vesicles, are included in the endomembrane system. Chloroplasts, peroxisomes, and mitochondria do not make up the endomembrane system.

To produce proteins in the cell, the rough endoplasmic reticulum is crucial. The cell would lack crucial proteins and other organelles would be unable to perform their duties if the rough ER were not functioning properly.

For more information on rough endoplasmic reticulum kindly visit to

https://brainly.com/question/13118914

#SPJ4

Vhich of the following demonstrates the central dogma of molecular biologists? (1 point) O Gene expression relies on environmental factors that determine which traits are dominant. O DNA and RNA hold the code to create proteins that are the key to gene expression. O DNA and RNA mutate into either harmful or helpful effects on the human body. O Proteins replicate DNA which gives the expression of traits to an organism.​

Answers

The following demonstrates the critical dogma of molecular biologists option B DNA and RNA maintain the code to create proteins that are the important thing to gene expression.

Option B alternative B DNA and RNA maintain the code to create proteins which are important things to gene expression.

The primary dogma of molecular biology is “DNA makes RNA makes protein.” This general rule emphasizes the order of activities from transcription thru translation and gives the premise for tons of genetic code research within the post-double helix 1950s.

The crucial dogma of molecular biology states that DNA contains instructions for creating a protein, which might be copied with the aid of RNA. RNA then makes use of the instructions to make a protein. In quick DNA → RNA → Protein, or DNA to RNA to Protein.

Learn more about molecular biology  here
https://brainly.com/question/26044300

#SPJ4

DNA and RNA hold the code to create proteins that are the key to gene expression demonstrates the central dogma of molecular biologists.

The basic idea of molecular biology describes how genetic material goes from DNA to RNA to create a protein, which is an important final result. The central dogma is that RNA acts as a messenger, carrying information from the DNA to the ribosomes, where it is utilised to make all of our proteins.

Ribosomes serve as factories in the cell where information is "transformed" from a code into a useful part. The process by which the DNA instructions are converted into a usable product is known as gene expression. The two critical stages of gene expression are transcription and translation. Every cell's DNA includes information that, during transcription, is converted into succinct, transportable RNA messages.

To know more about central dogma visit : https://brainly.com/question/16580285

#SPJ9

TRUE or FALSE: As time passes, the universe is
becoming more disorderly.

Answers

Answer:

true

Explanation:

Three genes, X, Y, and Z, are located either on the same chromosome, or on different chromosomes. If the recombination frequency for X and Y was found to be 25%, and Y and Z was found to be 60%, this would mean that

-genes X and Y are on the same chromosome.

-genes Y and Z are on different chromosomes.

-both of the other answers are correct​

Answers

Answer: -genes X and Y are on the same chromosome.

Explanation:

Which statement BEST describes why warm ocean currents are usually surface currents?

Answers

Answer:

density

Explanation:

the warm currents are usually at the surface because they are less dense then the cold currents the colder current is the farther down in the ocean it will be

Warm water is less dense than cold water

Internal and external information is brought to the brain in the process of

Answers

Answer: Consciousness

Diverse plant communities have species representing a variety of plant types such as grasses, shrubs, succulents,
hardwood trees, softwood trees, vines, ferns, and so on. What factors increase a community's diversity? Age of the
community? Energy input? Moisture? Nutrients? Disturbance? Human activity? How do they do so?

Answers

The factors that increase a community's diversity are the age of the community; Energy input and Human activity.

There are many ways to describe diversity. Assuming that diversity is defined broadly, as opposed to, say, genetic diversity, there are many things that can influence the diversity of a group.

The diversity may be impacted by the landscape's complexity, the community's age, and its surroundings.

Diversity will be impacted by the diversity of the habitat or landscape itself. There isn't much possibility for variety if the habitat is continually boreal forest, with the same species distribution and composition throughout.

There is potential for more ecological niches in an environment with a variety of habitat types. Different species may inhabit various niches and tailor their adaptations to them.

To learn more about Diversity visit: https://brainly.com/question/13122961

#SPJ1

the transformation of energy during cellular respiration can be followed from glucose to

Answers

Answer:

ATP OR adenosine triphosphate

Explanation:

is chemical energy the cell can use

In the science field we use the metric units, this is due to
A. Metric units are universally accepted.
B. Metric is a universal scientific language.
C. Both

Answers

In the science field we use the metric units because of both the given reasons i.e. A. Metric units are universally accepted. B. Metric is a universal scientific language.

What is a metric unit system?

The decimalized system based on the meter that had been adopted in France in the 1790s was replaced by the metric system, which is a system of measurement.

What do you mean by universal?

Including or covering all or a whole collectively or distributively without limit or exception.

Why we use Metric System ?

A standardized approach that enables international scientists to communicate and compare notes is necessary. Without a standard, they would have to spend extra time converting measurements between different systems of measuring, which would reduce accuracy. SI or metric unit is favoured because, among other things, it is not based on the bodily parts of individuals who lived hundreds of years ago. A universal standard that anyone can verify serves as the foundation of this sleek and straightforward system.

Hence, 'In the science field we use the metric units because of both the given reasons i.e. A. Metric units are universally accepted. B. Metric is a universal scientific language.

To know more about Metric unit visit

https://brainly.com/question/28524514

#SPJ1

Remember the law of conservation of mass. The human body uses cellular respiration to make energy. Using the chemical equation for cellular respiration, explain how the amounts ofoxygen and carbon dioxide inhaled by the lungs is different from the amounts exhaled. Explain your answer in 1-2 sentences. (2 points)​

Answers

With the equation of cellular respiration C₆H₁₂O₆ + 6O₂ → 6CO₂+ 6H₂O, gaseous exchange takes place, glucose reacts with oxygen forming Adenosine Triphosphate used by cells.

About 21% of oxygen and 0.4% of carbon dioxide of air is inhaled while the air we breathe out contains 16.4% of oxygen and 4.4% of carbon dioxide because cells use oxygen inhaled to release energy and carbon dioxide as byproduct.

How does Cellular Respiration work?

Cellular respiration is how organisms convert fuel into energy and nutrients by combining oxygen with food molecules, sending the chemical energy for life sustaining activities while expelling carbon dioxide and water.

We inhale 21% of oxygen and 0.4% of carbon dioxide and exhale 16.4% of oxygen and 4.4% of carbon dioxide as by product during the process of cellular respiration.

Find out more on cellular respiration here: https://brainly.com/question/25921566

#SPJ1

Using the following genomic sequence:


1) Underline each Intron


2) Circle each exon


GUUAUGAGUCGUUGGCAUUAAUCUUUCCUUAUGAUUGUCGCUGAUCGUUAG

UCGUCCAUGCGUGGUGGCUGACUUCCAAUGACCAAAUCUUCGGUGGCGGAG

UAACAUAUAAGAAUGACCAAAAGGCGUCGAUGAGGAUGUGGCAAUUAACAUC

Answers

Explanation:

Here the underlined parts are STOP CODONS NO INTRONS WERE FOUND IN THE GIVEN SEQUENCE

Intron: AUC, UUU, CUA, CGC, UUA, AGA, AGG, CGU, AUG, AGG, AUG, UGG

Exon: GUU AUG AGU CGU UGG CAU UAA UCU UUC CUU AUG AUU GUC GCU GAU CGU UAG, UCG UCC AUG CGU GUG GCU GAC UUC CAA UGA CCA AAU CUU CGG UGG CGG AGU, UAA C AUU AUA AGA AUG ACC AAA AGG CGU CGA UGA GGA UGU GGC AAU UUA ACA UC

What are Introns and Exons?

Parts of a gene are known as introns and exons in molecular biology. While introns are the non-coding portions that break up coding sequences, exons are the coding areas of a gene that carry the information required to construct a protein.

Introns are not expressed, whereas exons are the regions of a gene that are. Introns are cut out and exons are spliced together to create the final messenger RNA (mRNA) which will be translated into a protein after a gene has been transcribed into mRNA.

Therefore, Intron: AUC, UUU, CUA, CGC, UUA, AGA, AGG, CGU, AUG, AGG, AUG, UGG

Exon: GUU AUG AGU CGU UGG CAU UAA UCU UUC CUU AUG AUU GUC GCU GAU CGU UAG, UCG UCC AUG CGU GUG GCU GAC UUC CAA UGA CCA AAU CUU CGG UGG CGG AGU, UAA C AUU AUA AGA AUG ACC AAA AGG CGU CGA UGA GGA UGU GGC AAU UUA ACA UC

Learn more about Introns and Exons, here:

https://brainly.com/question/26464408

#SPJ2

Which criterion is a requirement for naturalization as a US citizen?

A.
The person must be a lawful, permanent resident for five years.
B.
The person must read, write, and speak at least two languages.
C.
The person must be related to a natural or naturalized citizen.
D.
The person must be between the ages of 18 and 55 years old

Answers

The person must be a lawful, permanent resident for five years is the criterion that is a requirement for naturalization as a US citizen.

You must be at least 18 years old, be able to read, speak, and write English, have knowledge of US history and government, adhere to the laws outlined in the US constitution, and have lived on US soil for at least 30 months prior to applying in order to qualify for citizenship as an American. There are also other requirements that must be met in order to qualify for citizenship as an American.

Following compliance with the criteria outlined by Congress in the Immigration and Nationality Act, a lawful permanent resident is granted U.S. citizenship through the naturalization process (INA).

To learn more about Naturalization visit: https://brainly.com/question/17205840

#SPJ1

Which systems work together so oxygen can be
distributed to the cells of your body? How do these two
systems work together to accomplish this task?

Answers

Circulatory system and respiratory system work together so oxygen can be distributed to the cells of your body.

The circulatory and respiratory systems collaborate to move blood and oxygen around the body. The trachea, bronchi, and bronchioles transport air into and out of the lungs. The pulmonary arteries and veins connect to the heart and transport blood into and out of the lungs.

To obtain oxygen, blood travels from the heart to the lungs. The respiratory system includes the lungs. The exchange of gases between tissues and blood is a critical function of the circulatory system. Blood absorbs oxygen and emits carbon dioxide in the lungs of humans, other mammals, and birds. Thus, the circulatory and respiratory systems work in tandem to obtain oxygen and expel carbon dioxide.

To learn more about Circulatory system and respiratory system, here

https://brainly.com/question/3305440

#SPJ1

A human cell containing 22 non-sex chromosomes and a Y chromosome is
O a male non-sex cell
O a fertilized egg
O a sperm
O an egg

Answers

The correct option is 'sperm cell'.

Which of the following
describes parasitic worms?
A. single-celled eukaryotes that are usually
found in contaminated water or insect bites
B. living, single celled organism that are the
most common pathogen and can be treated
with antibiotics
C. multicellular pathogen that lives in the
intestinal tract of host to absorb nutrients this
D. non-living pathogen that can't be treated
with antibiotics and reproduces with a host

Answers

Answer:

C. multicellular pathogen that lives in the intestinal tract of host to absorb nutrients this.

Explanation:

Answer:

c) multicellular pathogen that lives in intestinal tract of host to absorb nutrients

Explanation:

Parasitic worms are the multicellular pathogen that lives in the intestinal tract of host to absorb the nutrients. Therefore, the option (c) is the correct answer.

Can someone tell me a environmental problem related to biodiversity for my project?

Answers

Answer: alteration, and loss of habitats, pollution, and climate change.

Explanation: Theres 3 have a good day

Answer:

"Biodiversity,

or the variety of all living things on our planet, has been declining at an alarming rate in recent years, mainly due to human activities, such as land use changes, pollution and climate change."

Explanation:

animals are a. Prokaryotic without a cell wall b. Eukaryotic without a cell wall c. Eukaryotic with a cell wall d. Prokaryotic with a cell wall please answer quickly ​

Answers

Answer:

b.

Explanation:

Animals, plants, fungi, and protists are all eukaryotes

Primary succession involves the _____ establishment of communities of different species in mostly lifeless areas.
A. rapid
B. gradual
C. orderly

Answers

Primary succession involves the gradual establishment of communities of different species in mostly lifeless areas.

The correct answer choice from above is option b.

What is meant by primary succession?

Primary succession can simply be defined as that association of living things whereby these organisms are the first that first colonizes a barren habitat. In order words, it simply refers to the ecological association of plants and animals such that they are are ones that inhabit the region first.

In conclusion, we can now confirm from the explanation above that this primary succession is a succession which starts from scratch.

Read more primary succession:

https://brainly.com/question/678251

#SPJ1

what symbiotic relationship between a wolves & Bear

Answers

Because bears easily oust wolves from their kills, bears may discover more ungulate carcasses over a longer period of time because wolves forage on ungulates all year long.

what coexists harmoniously with wolves?

Petroglyphs on cave walls depict the symbiotic interaction between the wolf and the grizzly bear. Since the end of the last Ice Age, these two wild animals of the North have been involved in an amazing survival dance.

What is the bear's symbiotic relationship?

Bear Lice, which are around 2 mm long and dwell on the surface of the bear and eat, coexist in harmony with Black Bears.

To know more about wolves & Bear visit:-

https://brainly.com/question/12383298

#SPJ1

Which are examples of
infections caused by
protists?
A. Strep throat, botulism, and anthrax
B. common cold, flu, and chicken pox
C. Malaria, African Sleeping sickness,
and intestinal disease this
D. Trichinosis, hook worm, and
elephantiasis

Answers

The answer is C.

- Malaria is caused by the protist Plasmodium protozoa.
- Sleeping sickness is caused by the protist Trypanosoma protozoa.

Answer:

c) Malaria, African Sleeping sickness, and intestinal diseases.

Explanation:

Malaria, African Sleeping sickness, and intestinal diseases are the examples of infections caused by protists. Therefore, the option (c) is the correct answer.

A model of onion root meristem cells during cell division is shown here. Which explanation is true about the cell labeled with the letter A? Select all that apply.

A) The chromosomes are independently assorting to ensure that the haploid daughter cells are genetically diverse.
B) The chromosomes are migrating to the center of the cell to cause a fertilization event resulting in a diploid cell.
C) The chromosomes are undergoing crossing over to ensure that the daughter cells are genetically diverse from the parent cell.
D) The chromosomes were duplicated prior to mitosis to ensure that a full complement of genetic material is passed to the daughter cells.
E) The chromosomes are being pulled to opposite sides of the dividing cell to ensure a full complement of genetic material is passed to the daughter cells.

Answers

Answer: d

Explanation:

Answer: It is D and E



Explanation:

Other Questions
7) When buyers in a market have market power, then the A) Product price is higher B) Number of sellers rises c) Number of sellers falls D) Product price is lower based on the constant demand assumption in the economic order quantity (eoq) model, the average cycle inventory is: a woman with a progressively enlarging neck comes into the clinic. she mentions that she has been in a foreign country for the previous 3 months and that she didn't eat much while she was there because she didn't like the food. she also mentions that she becomes dizzy when lifting her arms to do normal household chores or when dressing. what endocrine condition should the nurse expect the health care provider to diagnose? a popular haberdashery could take a customer's measurements in the afternoon and produce a dandy suit ready for customer pickup by next morning. their competitive priority was: Electioneering can best be described as _________. A. Actively campaigning for and supporting a poltical candidate b. Rigging an election to get the result you want c. Running for public office in order to support a specific cause d. Pursuading public officials to take actions favorable to an interest group please select the best answer from the choices provided a b c d. explain isabella bird's solution to the problem that comes up in american apartheid (1993), douglas massey and nancy a. denton argue that ________ is/are responsible for the perpetuation of black poverty and the continued polarization of black and white people how long does it take for monistat 3 to dissolve BRAINLY USERS I NEED HELPSo a freshman in algebra 1 and im on unit 4 i been stuck on this question trying to find out how to solve it for almost over 15 minutes can you please help Triangle abc ha a perimeter of 22cmAb =8cmBc=5I triangle abc a right angle triangle cash donations to public charities are limited to % of a taxpayer's agi. donations of capital gain property to public charities are generally limited to dr. kang, a cognitive psychologist, conducts an experiment examining the effect of emotion on memory. he provides lists of 15 words to two groups of participants at his university. he puts the names of all the participants in a hat. the first 20 names he assigns to group a and the last 20 he assigns to group b. group a is given a list of words that are very emotional in content (e.g., passion, murder). group b is given a list of words that are neutral in content (e.g., houseplant, desk). he then measures how many words each group is able to remember after being distracted for 5 minutes by watching a video about the history of the university. he finds that group a remembers 15% more words than group b. dr. kang sends his study to a journal to be published. one of the peer reviewers questions the way dr. kang manipulated emotion, arguing that being exposed to emotional words does not make one emotional. the reviewer is questioning which of the following? Some doctors recommend that men drink 3 liters of water every day. There are approximately 29. 6 milliliters in 1 fluid ounce. Which measurement is closest to the number of fluid ounces in 3 liters?. a rocket is 1 mile above the earth One minute and 5 miles above earth in three minutes. what is the rocket rate of change in miles per minute teen obesity: the 2013 national youth risk behavior survey (yrbs) reported that 13.7% of u.s. students in grades 9 through 12 who attend public and private school were obese. after seeing extensive efforts to educate parents and teens on healthy lifestyles, we want to know if the proportion has decreased this year. we select a random sample of 200 u.s. students and find that 11% are obese.after performing the hypothesis test for p What immigrant groups helped build the transcontinental railroad? Chee buys a two-pint bottle of juice for $3.52. What is the unit rate of the cost of the juice per fluid ounce? Which of the following isTRUE about viruses?A. Viruses CANNOT be cured byantibiotics. ThisB. Viruses are easily cured byantibiotics.C. All viruses can be cured byantibiotics.D. Many viruses are able to be curedwith antibiotics. consider the signal transduction pathway in model 3. what event begins the process of producing a cellular response? write 804 billion in ordinary decimal notation and in scientific notation