8.
What is meant by the term base-pairing? How is base-paring involved in DNA replication?

Answers

Answer 1

Answer: Hydrogen bonds form only between specific base pairs. ase pairing ensures that the complementary strands produced are identical to the original strands.

Explanation:


Related Questions

sharks
The vertebrate with the fewest bones are probably sharks (and relatives), which have a skeleton made mostly of cartilage; only their jaws are bone. The vertebrate with the fewest bones are probably sharks (and relatives), which have a skeleton made mostly of cartilage; only their jaws are bone.

Answers


This is my answer it is D :]

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Which option percent of valid hypothesis in the correct form?
A if a cotton plant receives 100 ml of water ever day it will display steady growth
B if cotton plant need consistent amount of water to grow steadily than the cotton plant that receives 100 mL of water Everyday Will displayed study group
C if a cotton plant needs a constant amount of water to grow steadily than a contact that displays Teddy Grove and you will receive a hundred mL of water every day
D the cotton plant displays steady growth it will receive 100 ml of water every day

Answers

The answer to the question is possibly A

Help me with this I’ll give 50points !!

Answers

Answer:

straightLustre,shinemirror Transparent,propertynot at depth,faster 7.oblique,blocks
StraightLustre,ShineMirrorTransparency, PropertyNot deep,less fastersee,redoblique ,blockswood,most of metals,Board,pen

Hope it helps

Question - All of the oxygen on the earth comes from

Answers:
1. producers releaseing it as a a product of photosynthesis


2. the clouds making it when the earth formed


3. heterotrophs breathing it out into the atmosphere

Answers

Answer:

1. producers releasing it as a product of photosynthesis

Explanation:

I hope it helps ❤❤

1. What is the function of the Circulatory/Cardiovascular System?

2. Why do you need to have blood circulate to all the parts of the body?

Answers

Answer:

1. Attires carry blood away from the heart and veins carry blood back to the heart. The circulatory system Carrie's oxygen, nutrients and hormones to cells, and removes waste products like carbon dioxide. These roadways travel in one direction only, to keep things going where they should

Answer:

Explanation:

So your body can function properly. Its what make our bodies work. It also supplies oxygen to the brain and other organs and promotes healthier skin

why is it important to have maps of the ocean floor, such as those gathered with SeaBeam technology

Answers

Since oceans cover 71% of the Earth’s surface, understanding what the seafloor looks like, and where different processes, such as ocean currents are active, is hugely important. Mapping the seafloor helps to work out things like where different types of fish live, where resources may be, such as rare metals and fossil fuels, and whether there is a risk of underwater landslides happening that might cause a tsunami. Mapping the seafloor is very challenging, because some cannot use the same techniques that some would use on land. To map the deep ocean, there's a tool used called a multibeam echo-sounder, which is attached to a ship or a submarine vessel.

Which of these characteristics is often used as a measure of an ecosystems health? A. The variety of species that lives there B. The number of people who live there C. The amount of population that occurs there D. The types of activities that can be done there

Answers

Answer:

A

Explanation:

Because the more species that live their can determine how well the environment is doing.And that their is enough resources for them to survive.

11. Cheetahs have been through a genetic bottleneck; evidence for this is that
A little natural selection occurs in this species.
B. the body is long thin, and graceful.
c. there is very little genetic variability.
D. these cats are members of an endangered species.
E. they originally came from sm all areas of Africa.

Answers

Cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).

What is a genetic bottleneck?

A genetic bottleneck is a natural process where a population and/or species lost part of this genetic diversity.

A genetic bottleneck is a process that can be caused by catastrophic natural disasters.

The genetic bottleneck is evidenced by the lack of genetic variability.

In conclusion, cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).

Learn more in:

https://brainly.com/question/8195651

Helpppppppppppppppppppppppppppppppppp

Answers

Answer:

umm i dont understand your question

Explanation:

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

is the black death airborne ?? apparently it isn’t but then why did ppl use those masks ?

Answers

The most common explanation of the transmission of the Black Death is flea bites. Infected fleas were carried on rodents, and these fleas transmitted the virus to humans.

There are still several different theories about how the Black Death was spread, however. There's a Wiki page called "Theories of the Black Death" that may be helpful.

At the time of the Black Death, bacteria and viruses hadn't been discovered yet. People thought that sickness was transferred through bad smells, which were called "miasma."

The long beaks of the masks were stuffed with strong-smelling herbs, spices, and dried flowers—lavender, roses, peppermint—which were thought to keep away the "evil" smells that were thought to cause disease.

Pretty cool stuff!

What are the four dna bases

Answers

Answer:

Adenine (A), Guanine (G), Cytosine (C), and Thymine (T)

Explanation:

Hope this helps!

⚠️Second time posting this⚠️
the factors that control genes are called "alleles".
True
or
false

Answers

Answer

Explanation:

I think its true

if a sample known to be about 11,460 years old and has 400 carbon 14 Adams how many atoms are in the sample when organisms just died

Answers

Answer:

There are 1600 atoms when organism just died.

Explanation:

The statement is incorrect. The correct statement is:

If a sample known to be about 11,460 years old and has 400 carbon 14 atoms. How many atoms are in the sample when organisms just died?

The amount of atoms associated with radioactive isotopes decreases exponentially in time by means of the following formula:

[tex]n(t) = n_{o}\cdot e^{-\frac{t}{\tau} }[/tex] (1)

Where:

[tex]n_{o}[/tex] - Initial amount of atoms.

[tex]n(t)[/tex] - Current amount of atoms.

[tex]t[/tex] - Time, measured in years.

[tex]\tau[/tex] - Time constant, measured in years.

In addition, the time constant can be calculated in terms of the half-life of the radioactive isotope ([tex]t_{1/2}[/tex]), measured in years:

[tex]\tau = \frac{t_{1/2}}{\ln 2}[/tex] (2)

If we know that [tex]t_{1/2} = 5,730\,yr[/tex], [tex]t = 11,460\,yr[/tex] and [tex]n(11,460\,yr) = 400[/tex], then the initial amount of atoms is:

[tex]n_{o} = \frac{n(t)}{e^{-\frac{t}{\tau} }}[/tex]

[tex]\tau = \frac{5,730\,yr}{\ln 2}[/tex]

[tex]\tau \approx 8,266.643\,yr[/tex]

[tex]n_{o} = \frac{400}{e^{-\frac{11,460\,yr}{8,266.643\,yr} }}[/tex]

[tex]n_{o} \approx 1600[/tex]

There are 1600 atoms when organism just died.

Which of the following describes exploratory analysis?

Answers

What are the options?????





What happens to excess carbohydrates in animals?
They are stored as fat.
They are stored as protein.
They are stored in nucleic acids.
They are stored as sugar.

Answers

Answer:

A-They are stored as fat.

Explanation:

In animals, the excess of carbohydrates or glucose is first converted into glycogen (polysaccharide) through the process called glycogenesis. ... When glycogen reservoirs are saturated, excess carbohydrates, as well as proteins, are converted into fats which are then majorly stored in adipose tissues.

the answer would be they are stored as fat :)))

What is the role of protein channels in the cell membrane?

Answers

Answer:

protein channels to cell membranes

Which accurately describes reproduction in gymnosperms? Select four options. Some require heat for seed dispersal. Female cones produce pollen. Most gymnosperms produce male and female cones. Fertilized ovules grow into seeds. Male and female cones may grow on the same plant.

Answers

Answer:

A, C, D, and E are corecct

Explanation:

Some require heat for seed dispersal.Most gymnosperms produce male and female cones. Fertilized ovules grow into seeds. Male and female cones may grow on the same plant.

Answer:

A C D E

Explanation:

I just took the quiz and got the question right

7. Light-absorbing molecules like chlorophyll found in the photosynthetic organisms are called
(LT#2)
A. thylakoids B. grana C.pigments
D. stroma

Answers

Answer:

C. pigment

Explanation:

Pls help i will mark brainliest

Answers

Answer:

B. Warm ocean water...

Explanation:

the constitution says laws passed by Congress are_______to state laws

Answers

ANSWER: The constitution says laws passed by Congress are superior  to state laws

PLEASE GIVE BRAINLIEST!

TY AND HAVE A NICE DAY

Write any three differences between infectious and non- infectious disease


please its aurgent ​

Answers

Answer:

Infectious diseases are transmitted from person-to-person through the transfer of a pathogen such as bacteria, viruses, fungi or parasites. A non-infectious disease cannot be transmitted through a pathogen and is caused by a variety of other circumstantial factors.

Explanation:

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Gen K mengode rambut keriting dan gen k mengode rambut lurus, K dominan terhadap
k. Gen H mengode warna kulit hitam dan gen h mengode warna kulit putih. Kombinasi
dari gen-gen tersebut yang menunjukkan fenotip rambut keriting kulit putih adalah..​

Answers

Answer:

The answer is "kkHh".

Explanation:

In this question, the Tight curls Gen K code and short hair k codes, which is used in the generation of the H black and gene H white color code, which is the gene H code. It is the synthesis of the genes that reveals it's solid black, and skin phenotype, that's why the kkHh is the correct answer is.

is pathogen a bacteria and a virus? Or just a virus or just a bacteria ?

Answers

Answer:

Both a Bacteria and Viruse

Explanation:

Pathogens are taxonomically widely diverse and comprise viruses and bacteria as well as unicellular and multicellular eukaryotes.

A pathogen is both bacteria and virus but there are other pathogens as well. Pathogen is a very broad term and is just any organism that causes decease.

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

what was not included in john dalton's description of the atom

Answers

Answer:

Nucleus containing protons and neutrons  and electrons

Explanation:

Answer:

This is what i found-

Explanation:

The indivisibility of an atom was proved wrong: an atom can be further subdivided into protons, neutrons and electrons. However an atom is the smallest particle that takes part in chemical reactions. According to Dalton, the atoms of same element are similar in all respects.

the reactants of photosynthesis are

a: organic compounds
b: glucose and sunlight
c: glucose and water
d: glucose and carbon dioxide
e: water and carbon dioxide

Answers

Answer:

I think its e

Explanation:

Photosynthesis requires sunlight, carbon dioxide, and water as starting reactants

Other Questions
Determine the correct inequality for the unknown side of the triangle.ABCD if 50% is 7 what is 25%, 75%, and 100% In which of the situations can information about Tyler be represented by the expression r + 3, when r represents information about Ray? Select three options.Tyler is 3 years older than Ray.Tyler is 3 inches taller than Ray.Tyler is 3 pounds lighter than Ray.Tyler walked 3 miles farther than Ray.Tyler spent one-third the amount Ray spent. help please!!! will give brainliest!! I kind of need help. I completely forgot how to do ratios Leaving a juicy, tender roast in the oven too long will also produce an unfavorable reaction and may set off a fire alarm! Besides quenching the flames, you might have to gnaw on a dried out slab of meat. Chefs are now experimenting with various substances to see what reaction they will get and how to use them with each new succulent dish.Read the passage above and identify the sensory images used.a.juicy, tenderc.succulent dishb.gnaw on a dried out slab of meatd.all of the above decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA Lane bought 12 pencils for$0.39 each. What was the total cost of thepencils before sales tax was added? Writing: A story The best day Pllsssss, Red light waves have a longer wavelength than green light waves. What can you conclude from this? PLEASE HELP IF YOU WANT ME TO GIVE YOU BRAINLEIST AND LIKE YOUR COMMENT!!A. Green light waves have the same frequency as red ones.B. Green light waves have a higher frequency than red ones.C. Green light waves have a smaller frequency than red ones. What evidence show that Judaism unified the Jewish 12 + r = 3I need the answer to this problem? Tell which number is greater.1/3, 30% Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines Which Latin American country has the most free (from government control) economy? (15 points)A. MexicoB. BrazilC. Cuba Last month, a car dealer sold 50 cars. This month, 60 cars were sold. Find the percent increase in sales. 1. Choose a topic: how colors make you feelbody and mind2. Choose a way to express yourself: a song. a poemi a piece of graphic art3. Present your work. What 4 things did the Estruscans give to the Romans, NEED ANSWERS ASAP Apply: Which type of moth do you think was more common before the 19th century, when most trees were light in color? Why do many scholars consider the battle of Hastings to be the biggest event in English history?