The correct order of events of DNA replication is as follows:
DNA helicase unwinds DNAReplication fork is formedDNA polymerase attaches to the primerDNA polymerase adds nucleotides in the 5' to 3' directionOkazaki fragments are bound together by ligaseDNA REPLICATION:
DNA replication is the process by which the DNA of a living organism is multiplied into two identical copies. DNA is a double-stranded molecule, hence, it must first be separated into two single strands in order to be replicated. The following are the orderly steps involved in DNA replication:An enzyme called DNA helicase unwinds DNA into single strands. A Y-shaped structure called replication fork is formed by the two single strands.DNA polymerase attaches to the primer, which is a short segment of RNA. DNA polymerase adds nucleotides to the leading strand of DNA in the 5' to 3' directionOkazaki fragments, which are small fragments of DNA are bound together by ligase enzyme and added to the lagging strand.Learn more at: https://brainly.com/question/16464230?referrer=searchResults
How are chromosomes affected by aging
Answer:
delaying cell senescence, apoptosis, and death
Explanation:
Answer:
the enzyme telomerase adds specific DNA sequence repeats to the chromosome ends that are lost through cell division, thus restoring telomere length and delaying cell senescence, apoptosis, and death
Explanation:
all you need is in the photo
Answer:
Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.
Explanation:
hope this helps if not i'll try to figure out the answer for you
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
which layer of the earth is made out of melted metal?
The outer core. A molten nickle- iron alloy.
HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.
Answer:
No, because the scientist followed personalities which is pseudoscience.
Explanation:
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period
Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.
People born in October were more relaxed and could better handle stress
Is the scientist’s research considered science?
No, this are beliefs not necesarily true.
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
Why do you think that some definitions of forest have a certain percentage of the land that must be covered in trees?
Answer:
30 percent tree cover - 2000 - 2009JPEG ... of forest cover vary widely—as much as 6 percent of Earth's land area, or the equivalent area of China.
Explanation:
Please help me due tonight!
Answer:
Meiosis I ==> Interphase - Prophase - Metaphase - Anaphase - Telaphse - genes
Meiosis II ==> Prophase - Metaphase - Anaphase - Telaphase - genes
unlike mitosis which has only one form
Look at the plant in the picture below.
This plant is vascular but does not produce seeds. To which of the following groups does this plant belong?
A. flowering plants
B.
conifers
C.
ferns
D.
mosses
The following groups of plant belongs to ferns.
What are the characteristics of ferns?A fern is a member of a group of vascular plants that reproduce via spores and have neither seeds nor flowers.
In their natural environment, most ferns grow in humid forests or on the bank of a water source, so they generally require very moist soil. Even fern varieties that become drought tolerant as they mature usually require moist soil at planting time.
Similar to flowering plants, ferns have roots, stems and leaves. However, unlike flowering plants, ferns do not have flowers or seeds; instead, they usually reproduce sexually by tiny spores or sometimes can reproduce vegetatively, as exemplified by the walking fern.
Learn more about ferns:
https://brainly.com/question/9505707
#SPJ2
the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes
Answer:
Telophase
Explanation:
Answer 15 and 16 correctly and I will mark as brainliest
Answer:
I think its A and G
Answer:
15. B.
16. H
Explanation:
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis
Answer:
C
Explanation:
Thats the tea
Hope this helps ;)
The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.
Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.
Learn more about transcription and translation here.
https://brainly.com/question/29979094
#SPJ2
when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen
Answer:
Carbon dioxide
Answer:
Carbon Dioxide
Explanation:
Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.
What statement is best supported by this information?
A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.
Answer:
B.
Explanation:
Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
Explanation: just did the test its right.
please help meeeeeeeeeee
Answer:
D
Explanation:
What are the 3 main types of star "corpses"? plz hurry
Answer: white dwarfs, neutron stars, and black holes
Explanation:
The folded plasma membrane inside the cell is the ______.
A: endoplasmic reticulum
B: mitochondria
C: vacuole
D: vesicle
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
Two offspring from same parents can have different phenotypes. How is this possible?
Answer:
Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.
Explanation:
Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.
What is heterozygote?Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.
The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.
Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.
To learn more about heterozygote, refer to the link below:
https://brainly.com/question/12891396
#SPJ2
i need some help on this i dont know can someone plz help me
Answer:
D is your answer I believe
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
20 points and brainliest! Explain how you got the answer!
Answer:
No of groups studied
As All other factors will effect the result ofvthe experiment.
But no matter how many groups you take to study they will show the same result
HOPE YOU GOT IT!
MARK ME AS BRAINIEST
Arrange these energy sources from highest to lowest percentage of worldwide use. 1, Nuclear 1. Coal * Hydroelectric
Explanation:
hydro coal nuclear i think it would like thst
The arrangement of the energy according to the highest to the lowest percentage of worldwide use is coal, hydroelectric and nuclear. The arrangement is 2, 3, and 1.
What is energy?Energy is a quantitative property that is used in doing any work. The energy is always transferred from one form to another form. It is present in the conserved form.
The energy which is used majorly is coal, then hydroelectricity, which is made by water then the nuclear power plant.
Thus, the arrangement is 2. Coal, 3, hydroelectric, 1. Nuclear energy.
Learn more about energy, here:
https://brainly.com/question/12396199
#SPJ2
How is evaporation related to precipitation?
Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?
Answer:
It can form bonds.
Explanation:
(I'm in ap bio so I know a lot, lol, hope that helps)
submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors
Answer:
biotic factors depend on abiotic factors for survival
Explanation:
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
Which other food items were digested by lactase, the enzyme that breaks down milk?
Answer:
im not sure what you mean by this question but ill answer the best way i can!
Explanation:
Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacksthese are foods containing lactose in them, which lactase breaks down.
hope this helps!