A 0.24 kg mass with a speed of 0.60 m/s has a head-on collision with a 0.26 kg mass that is traveling in the opposite direction at a speed of 0.20 m/s. Assuming that the collision is perfectly inelastic, what is the final speed of the combined masses?

Answers

Answer 1

The  final speed of the combined masses is 0.186m/s

According to the law of collision, the sum of the momentum of the bodies before the collision is equal to the momentum after the collision.

Mathematically;

m1u1 - m2u2 = (m1+m1)v

v is the final speed of the combined masses.

Substituting the given parameters;

0.24(0.6) - 0.26(0.2) = (0.24+0.26)v

0.144 - 0.052 = 0.5v

0.092 = 0.5v

v = 0.092/0.5

v = 0.184m/s

Hence the final speed of the combined masses is 0.186m/s

Learn more on collision here:  https://brainly.com/question/7538238


Related Questions

Connor rode an inner tube down a river. For 4.6 minutes, he moved downriver at 15 meters per minute. During this time, how far did he move?

Answers

Answer:

2 miles

Explanation:

What is the low end of the range of surface temperature for blue white stars

Answers

B 10,000 - 30,000 K Blue-white stars

A 7,500 - 10,000 K White stars

F 6,000 - 7,500 K Yellow-white stars

G 5,000 - 6,000 K Yellow stars (like the Sun)

The lowest temperature stars are red while the hottest stars are blue. Astronomers are able to measure the temperatures of the surfaces of stars by comparing their spectra to the spectrum of a black body.

Can someone please help me with number 10

Answers

Answer:

A

Explanation:

increase

Answer:

B???

Explanation:

The rate of it going up is lower than L

It might be D too.

if a 1000kg car goes from a speed of 6.5 m/s to a stop in 3 seconds what is the force acting on the car

Answers

Answer:

-6500N

Explanation:

F = ma

Note:  1N = 1 kg⋅m⋅s−2

a = (0-6.5m/s)/3s

a = -6.5m/s^2

F = 1000kg(-6.5m/s^2)

F = -6500kgm/s^2

F = -6500 N

Calculate the resistance of a 1km length, 1mm diameter wire made from:

a) constantan (\rho = 4.9 × 10-7 Ωm)
b) copper (\rho = 1.7 × 10-8 Ωm)

c) State which material is better suited for being used to make resistors, and justify your answer.
d) With 1 amp of current flowing through each of the wires how much energy is converted to heat?
e) What potential difference would be needed to force a current of 1 amp through that length of each type of wire?

Answers

From the values of resistivity, the resistance of copper wire is 22 Ω.

Let us recall that;

R = ρl/A

ρ = resistivity

l = length of the wire

A = cross sectional area of the wire

For constantan;

R = 4.9 × 10^-7  × 1 × 10^3/[3.14 × ((1 × 10^-3)/2)^2]

R = 620 Ω

For copper;

R =  1.7 × 10-8 × 1 × 10^3/[3.14 × ((1 × 10^-3)/2)^2]

R = 22 Ω

The material that is best suitable to make resistors is constantan wire.

For constantan, the energy converted to heat is;

I^2 R = (1)^2 ×  620 Ω = 620 W

For copper, the energy converted to heat is;

I^2R = (1)^2 × 22 Ω = 22Ω

The potential difference of constantan = IR = 1 ×  620 Ω =   620 V

The potential difference of copper =  = IR = 1 ×  22Ω  = 22 V

Learn more about resistivity:https://brainly.com/question/8106379

how many asteroids do scientists believe exist in the solar system?

Answers

Answer:

Astronomers think there are between 1.1 and 1.9 million asteroids in the solar system.

Explanation:

A moving coil meter has a resistance of 25 and indicate full scale deflection when a current of 4.0mA flows through it.How could this meter be converted to a millimeter having a full scale deflection for a current of 50 mA?​

Answers

GivenG=25,lg=10mA=10×10 power by 3A,v=100V
To find resistance(Rs)
Formula R

s=
lg−G
V


Calculations by formula
R

s=
(10×10
−3
−25
100


=10000−25
=9975
Ans- resistance by 9975Ω

By adding an external resistor of  287.5 Ω in series with the meter, the conversion of the moving coil meter to have a full-scale deflection for a current of 50 mA.

Current sensitivity (S) is the ratio of full-scale deflection current to full-scale deflection voltage.

S = I(fsd) / V(fsd).

S = 4.0 / 25

S = 0.16 mA/Ω

Desired current sensitivity for 50 mA (S(new)) = 50 mA / V(fsd)

(S(new)) = 50 mA / V(fsd)

(S(new)) =  50  / 0.16

(S(new)) =  312.5 Ω

Add External Resistor:

Add an external resistor (R(ext)) in series with the meter. Calculate R(ext) as the difference between R(new) and the internal resistance of the meter

(R(internal) = 25 Ω:

R(ext) = R(new) - R(internal)

R(ext) = 312.5 Ω - 25 Ω

R(ext) = 287.5 Ω

By adding an external resistor of  287.5 Ω in series with the meter, the conversion of the moving coil meter to have a full-scale deflection for a current of 50 mA. This will achieve the desired result.

To know more about the external resistor:

https://brainly.com/question/32843695

#SPJ3

Which is the correct answer

Answers

Answer:

C

Explanation:

All of the other options are affecting the gravitational force and opposing force that pushed upwards, the diagram represents an object that is not moving up or down.

can somebody explain it to me please?​

Answers

Range be R and height be h

[tex]\boxed{\sf R=\dfrac{u^2sin2\theta}{g}}[/tex]

[tex]\boxed{\sf h=\dfrac{u^2sin^2\theta}{2g}}[/tex]

u=initial velocity

theta is angle of projection.

g=acceleration due to gravity

ATQ

[tex]\\ \sf\longmapsto R=2h[/tex]

[tex]\\ \sf\longmapsto \dfrac{u^2sin2\theta}{g}=\dfrac{2u^2sin^2\theta}{2g}[/tex]

Cancelling required ones

[tex]\\ \sf\longmapsto sin^2\theta=sin2\theta[/tex]

sin2O=2sinOcosO

[tex]\\ \sf\longmapsto sin^2\theta=2sin\theta cos\theta [/tex]

[tex]\\ \sf\longmapsto \dfrac{sin^2\theta}{sin\theta cos\theta=2[/tex]

[tex]\\ \sf\longmapsto \dfrac{sin\theta}{cos\theta}=2[/tex]

[tex]\\ \sf\longmapsto tan\theta=2[/tex]

[tex]\\ \sf\longmapsto \theta=tan^{-1}(2)[/tex]

[tex]\\ \sf\longmapsto \theta=63.4°[/tex]

Done

Option B is correct

which is the following is a modern method used to pressure food

1. sprey drying

2.salting

3. smoking

4. Honey​

Answers

Answer:

1. Spray Drying

Explanation:

it is the most modern

when a rigid body rotates about a fixed axis, all the points in the body have the same

Answers

Hi there!

[tex]\large\boxed{\text{Angular acceleration.}}[/tex]

For a rigid body rotating about a fixed axis, its angular characteristics ⇒ angular acceleration and velocity are constant throughout.

However, its LINEAR velocities/accelerations differ because of the following relationships:

v = ωr

a = αr

Thus, a point closer to the axis of rotation has a smaller linear velocity or acceleration compared to a point along the edge.

A number line goes from 0 to 30. Closed circles are at 6 and 25. A line is drawn from point 6 to point 25. Ari is swimming a 25-meter race. After swimming 6 meters, she catches up to Amanda in a ratio of 7:3 from the 6-meter mark. At what meter mark does Ari catch up to Amanda? Round to the nearest tenth, if necessary. Ari catches up to Amanda at meters.

Answers

The position on the meter mark where Ari catches up with Amanda is 19.3 m.

The given parameters:

Range of the number line, = 0 to 30Position of the closed circles, = 6 and 25The ratio between the initial position and final position of Ari = 7:3

The distance between 6 m mark and 25 m mark is calculated as follows;

[tex]d = 25 \ m - \ 6 \ m\\\\\d = 19 \ m[/tex]

The distance traveled by Ari before catching up with Amanda is calculated as follows;

total ratio = 7 + 3 = 10

[tex]distance = \frac{7}{10} \times 19 \ m\\\\distance = 13.3 \ m[/tex]

The position of Ari from the 6 m mark is calculated as follows;

[tex]position = 6 \ m \ + \ 13.3 \ m\\\\position = 19.3 \ m[/tex]

Thus, the position on the meter mark where Ari catches up with Amanda is 19.3 m.

Learn more about partition of line segments here: https://brainly.com/question/11764811

Answer:

The above answer is correct! The answer is 19.3 meters :)

Explanation:

adding a ss for proof!

hope this helps :D


An airplane initially travels at 12 m/s when passing the "acceleration line." The airplane then
accelerates to 9 m/s2 until reaching its take off velocity of 40.0 m/s. What is the displacement of
the plane during the acceleration?

Answers

The displacement of  the plane during the acceleration is equal to 80.89 meters.

Given the following data:

Initial velocity = 12 m/sFinal velocity = 40 m/sAcceleration = 9 [tex]m/s^2[/tex]

To determine the displacement of  the plane during the acceleration, we would use the third equation of motion;

[tex]V^2 = U^2 + 2aS[/tex]

Where:

V is the final speed.U is the initial speed.a is the acceleration.S is the displacement traveled.

Substituting the given parameters into the formula, we have;

[tex]40^2 =12^2 + 2(9)S\\\\1600=144+18S\\\\18S=1600-144\\\\18S=1456\\\\S=\frac{1456}{18}[/tex]

Displacement, S = 80.89 meters.

Read more: https://brainly.com/question/13086772

Scientists suggest that the universe is still expanding. Which statement supports the claim made by the scientists?
The universe is 13.7 billion years old.
The galaxies in the universe are composed of dark matter.
The universe originated from a hot, dense point.
The galaxies in the universe are moving away from Earth at high speeds.

Answers

Answer:

The galaxies in the universe are moving away from Earth at high speeds.

Explanation:

Light years.

Describe the relative energies of particles in the
different States of matter.

Answers

Answer:

MATTER

ARE

OF

THREE

TYPES

SOLID

LIQUID

GAS

If you were traveling 60 mph and not wearing a seatbelt and collided with a fixed object, how fast would you be traveling when you hit the windshield

Answers

Your speed when your car hits a fixed object is 60 mph.

The given parameters:

Your initial speed, v = 60 mph

What is relative velocity?

Relative velocity tells us how fast we are traveling from a fixed point or reference point.

When travel at 60 mph in a car, you are moving at the same rate with the car.If you are not wearing a seat belt, when you hit a fixed object, you will move forward at the same rate as the car's speed.

Thus, we can conclude that your speed when your car hits a fixed object is 60 mph.

Learn more about relative velocity here: https://brainly.com/question/17228388


The position as a function of time for two objects moving along a straight line is shown in the graph,
Which statement is true about the distances the two object have traveled at time ty?
Object 1 has traveled a greater distance.
B
Object 2 has traveled a greater distance.
Both objects have traveled the same distance
D
The total distance traveled by each object cannot be compared using the graph.

Answers

The distance traveled by object 1 is greater than the distance traveled by object 2.

The shortest distance between two points is a straight line. More distance is covered when the path of motion is curved.

The distance traveled by each object at different time is compared as follows;

[tex]at \ t_ A , \ \ \ d_1>d_2 \ \ \ (d_2 = 0)\\\\at \ t_B, \ \ d_1 > d_2 \\\\at \ t_C, \ \ \ d_2 > d_1 \\\\at \ t_D \ \ \ d_1 = d_2\\\\at \ t_f \ \ \ d_2 > d_1 \ \ \ (d_1 = 0)[/tex]

The major distinguishing distance traveled by each occurs at [tex]t_B[/tex] and [tex]t_C[/tex].

[tex]d_{(t_B)} > d_{(t_C)} \\\\d_1 > d_2[/tex]

Thus, we can conclude that the distance traveled by object 1 is greater than the distance traveled by object 2.

Learn more about distance of object on straight and curved path here: https://brainly.com/question/7447601

2. Think about an activity you may have learned that involves muscle memory. Consider when you first learned the activity, how easy or difficult it was the first time, and if you can do it now without thinking. What happened in your brain during practices that resulted in muscle memory for you?

Answers

Answer:

Muscle memory is found in many everyday activities that become automatic and improve with practice, such as riding bicycles, driving motor vehicles, playing ball sports, typing on keyboards, entering PINs, playing musical instruments, poker, martial arts, and dancing.

Explanation:

Please help me answer this! ANSWER IN SCENTENCE FORMAT!!! :
Two factors that affect climate patterns on Earth are the tilt of Earth on its axis and the topography of Earth. Describe how these two factors affect the climate patterns of Earth.

Answers

The answer is
You need to look at the top of the axis
You need to look

Answer:

If you are saying How much does the tilt of the Earth affect the climate

This varies between a tilt of 22.1 and 24.5 degrees over a period of about 41,000 years. This trend not only affects the average temperature of the earth, but also how prominent the seasons are. Procession is a wobble in the earth's axis.

how is one kg mass defined in SI system​

Answers

Answer:

It is originally defined as the mass of one liter (10-3 cubic meter) of pure water.

The kilogram, symbol kg, is the SI unit of mass. It is defined by taking the fixed numerical value of the Planck constant h to be 6.626 070 15 × 10-34 when expressed in the unit J s, which is equal to kg m2 s -1 , where the meter and the second are defined in terms of c and ∆νCs.

A car accelerates from 10m/s to 22m/s in 10 seconds. What is the car’s acceleration?

A skydiver falls from an airplane and achieves a speed of 98m/s after 10 seconds. the starting speed is 0m/s.

Explain please.

Answers

Answer:

See attachment and below

Explanation:

A car accelerates from 10m/s to 22m/s in 10 seconds.

a = (22m/s - 10m/s)/10sec

a = 12m/s/10s

a = 1.2 m/s^2

A skydiver falls from an airplane and achieves a speed of 98m/s after 10 seconds. the starting speed is 0m/s

a = 98m/s - 0m/s)/10sec

a = 9.8 m/s^2

9.8 meters/sec^2 is the acceleration due to gravity.

A number line goes from negative 5 to positive 5. Point D is at negative 4 and point E is at positive 5. A line is drawn from point D to point E. What is the location of point F, which partitions the directed line segment from D to E into a 5:6 ratio? Negative one-eleventh One-eleventh Two-fifteenths Fifteen-halves.

Answers

The location of the point F that partitions a line segment from D to E ([tex]\overline{DE}[/tex]), that goes from negative 4 to positive 5, into a 5:6 ratio is fifteen halves (option 4).  

We need to calculate the segment of the line DE to find the location of point F.

Since point D is located at negative -4 and point E is at positive 5, we have:

[tex] \overline{DE} = E - D = 5 - (-4) = 9 [/tex]

Hence, the segment of the line DE ([tex]\overline{DE}[/tex]) is 9.

Knowing that point F partitions the line segment from D to E ([tex]\overline{DE}[/tex]) into a 5:6 ratio, its location would be:

[tex] F = \frac{5}{6}\overline{DE} = \frac{5}{6}9 = 5*\frac{3}{2} = \frac{15}{2} [/tex]  

Therefore, the location of point F is fifteen halves (option 4).

Learn more about segments here:

https://brainly.com/question/24472171?referrer=searchResultshttps://brainly.com/question/13270900?referrer=searchResults

       

I hope it helps you!

Answer:

The above answer is actually incorrect - the real answer is B. 1/11

Explanation:

I'm adding a ss below for proof

Hope this helped!

I'd really appreciate Brainliest :)

Your father bought you a pair of shoes. When you wore the shoes you realized there was a problem. The shoes were too long. Why might such prblm arise and how can it be mitigated?
Please answer it soon as possible ​

Answers

Answer: This problem may arise when your father never bought a shoe before. A male is bad at buying accesories and guessing the size, so the mother should have bought a pair of shoes. Or it can also be that your father has a short term memory or that he never knew the size of your feets. The feet might also have irregular growth for which it grows more than the normal size but such cases are rare to be seen.

You can prevent this by going with your father and selecting the shoe of your size. Or you can simply send your mother to buy it for you instead. Or another perfect choice could be is that you just dont ever send your father to buy anything for you or just never buy a pair of shoes. Wear the shoes that you always did or buy it yourself since your the one who is supposed to know the size of your feets. Another possible solution could be that you can make use of the money by gifitng them to someone close to you.

how did you identify the layer that belonged next to the cambrian layer?

Answers

Answer:

Morphology and phylogenetics revealed by fossils. Perhaps the strongest evidence to support the Cambrian evolutionary explosion of animal forms is the first clear appearance, in the Early Cambrian, of skeletal fossils representing members of many marine bilaterian animal phyla

A hair dryer transforms 10,000J of energy in 4s. What is its power?

Answers

Answer:

2500 W

Explanation:

Power is the rate at which work is done and can be found by using the formula

[tex]p = \frac{w}{t} \\ [/tex]

p is power in Watts ( W)

w is the workdone in J

t is time in s

From the question

w = 10,000 J

t = 4 s

We have

[tex]p = \frac{10000}{4} = 2500 \\ [/tex]

We have the final answer as

2500 W

Hope this helps you

Paint is an example of which of these?

compound

heterogeneous mixture

homogeneous mixture

none of the above

Answers

Answer:

Homogenous Mixture

Explanation:

The composition in paint is uniform so every part of it looks the same throughout the paint.

Name a device or gadget that converts
a) Heat energy to mechanical energy b) heat energy to light energy
c)electrical energy to sound energy

Answers

Answer:

a heat engine converts heat to mechanical energy.

electric generator

A block of mass 1.0 kg rests on a trolley of mass 4.0 kg. The coefficient of dynamic friction between the block and the trolley is 0.30. A horizontal force f = 5.0 n acts on the block. The block slides over the trolley. What is the acceleration of the trolley?

Answers

Answer:

the acceleration of the trolley is the acceleration of the trolley is 0.75 m/s^-2

Explanation:

friction force between the block and the trolley

= 1×0.3×9.8

= 2.94 N

(F = ma)

the acceleration of the trolley

= friction force/mass

= 2.94/4

= 0.735 m/s^-2

= 0.75 m/s^-2

The acceleration of the trolley will be 0.75 m/s².Acceleration is the ratio of the force to the mass.

What is the friction force?

It is a type of opposition force acting on the surface of the body that tries to oppose the motion of the body. its unit is Newton (N).

Mathematically it is defined as the product of the coefficient of friction and normal reaction.

The friction force between the block and the trolley is found as;

[tex]\rm F_f = \mu N \\\\ \rm F_f = \mu \times mg \\\\ \rm F_f = 0.30 \times 1 \timess 9.81 \\\\ \rm F_f= 2.94 \ N[/tex]

Mechanical force is equal to the product of the mass and the acceleration which is equal to the frictional force;

[tex]\rm F_f =F=ma \\\\ \rm a = \frac{F}{m} \\\\ \rm a = \frac{2.94}{4} \\\\ a=0.735 \ ms^{-2}[/tex]

Hence the acceleration of the trolley will be 0.75 m/s².Acceleration is the ratio of the force to the mass.

To learn more about the friction force refer to the link;

https://brainly.com/question/1714663

Given an unknown metal using C= {Q/(M T)} with energy added of 8,000. J, in which the temperature goes from 24.0 C to 28.0 C at a mass of 46.0 g, find its specific heat capacity?​

Answers

Answer:

47.48 J/g/K or 4.74 × 10⁴J/Kg/K

Explanation:

C(specific heat capacity)= Q(quantity of heat)/M(mass) × ∆T(change in temperature, Kelvin)

Q= 8000J

M= 46g or 46 ×10^-3Kg

T1= 24°C = 297K

T2 = 28°C = 301K

∆T = 301-297

= 4K

C= 8000/46 × 4

= 47.48 J/g/K or 4.74 × 10⁴J/Kg/K

Hi sweeties.. I want 5 solving questions about (Fluid Pressure and Temperature) and (Archimedes' Principle) may u help me?!​

Answers

Answer:

1) A 1L bottle, with a height of 30cm, full of water is emptied. The bottle is filled with oil (density = 920 kg/m^3). Calculate the change in pressure of the bottom of the first bottle. If you decide to put potatoes (assume its density is  1,8 kg/m^3), each one of a volume V = 10 cm^3, will they float?

2) The fusion temperature of the Nitrogen is -210°C and its boiling temperature is 77K. Calculate the difference between the fusion temperature and the boiling temperature.

Other Questions
Which model below shows the positions of the Sun, Moon, and Earth that have the greatest effect on ocean tides? Pleaseeee help meee with this!!!!!!!!!!!! Norton Company purchased a building on January 2 by signing a long-term $480,000 mortgage with monthly payments of $4,500. The mortgage carries an interest rate of 10 percent. The amount owed on the mortgage after the first payment will be A town has two shopping malls. A survey conducted on the shopping preferences of the town's residents showed that 62% of the residents visit Comet Mall, 73% of the residents visit Star Mall, and 48% of the residents visit both malls. The probability that a resident is chosen at random shops at either Comet Mall or at Star Mall is Help me pleaseeeeeeeeeee AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA {(23,4),(-3,8),(-25,-21),(20,13),(21,-14)} what is the domain and range Accelerated mammary gland development in intellectually disabled. What is the product of 44(4-7)(4)?-16O-1 -12-1008DONE Determine the intercepts of the line. I will give brainliest Imagine you own a company that makes YOUR FAVORITE PRODUCT. Read the excerpt from a text about online learning. "Virtual schools were growing quite quickly," said Christina Martin, a policy analyst at the Cascade Policy Institute, a free-market think tank based in Portland, Ore. . . . The big issue, she said, was fairness. Some students have access to virtual schools because they have a learning coach to stay home with them, while others dont. Also, Internet connections can be costly, and not every family has one. And families have to pay for their own printing. . . . "An adult must stay with a child during the day and make sure theyre doing their work. " This information would best support a claim about students need for personal coaches. Internet supervision. High-tech gadgets. Equal access to technology. (PHOTOGRAPHY) Rebecca is planning to take photographs on her trip to see the California redwoods. The California redwoods are very, very large trees. She wants to make sure that everyone who sees her photographs understand how giant the trees are. What might she do to help her audience see the scale of the redwoods?Group of answer choicesAsk her parents to park their car near the base of the tree so that it will be in the photograph, too.Take a closeup of the trees bark so viewers get a sense of the level of detail the tree has.Take a photo with more than one redwood tree in the frame.Position herself so that she captures the sky and clouds behind the redwood tree.PLEASE HELP ASAP if the telephone was invented in 1876 how old was it in 1991 how long had it been around 5. My classmate will ask questions to our teacher nor plz help me..In my town, the Chinese Cultural Center offers language lessons on Saturday mornings from 9 to noon. My parents were born in China, but I wasnt. My parents were educated in a Chinese language called Mandarin, but I go to a school where we all speak English. As a result, my family worries that even if we speak Chinese together at home (and we usually do), I might not truly understand our culture or learn how to read or write enough Chinese characters to be literate and fluent.The narrator's parentsI. were born in ChinaII. spoke Mandarin at schoolIII. never learned EnglishAI onlyBII onlyCI and II onlyDI, II, and III In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction Divide 63.5 0.25 round the quotient to the nearest ten-thousandth PLZZZZZZZZZ HELPABC Order and Definitions1.React2.Shift3.Specify4.Thesis5.audience6.format7.purpose8.introduction9.focus10.conclusion11.influence12.fleeting13.mentorship14.normal15.participate16.positive17.circumstantial18.emotional19.contagion20.fleetingABC Order and DefinitionsWrite down 45 affixes containing the sufffix:-or-ment-ness