Answer:
The first one is It helps the founder defend itself
The second one is A viceroy butterfly has the same markings as a bad-tasting monarch butter fly
The third one is Mimicry if im wrong do grouping
The fourth one is The light moths will be captured by predators more easily than the dark moths, and the population of the dark moths will rise
The fifth one is TBH i cant answer it i dont see the table
The sixth one is The green insect population will increase and the yellow insect population will decrease
The seventh one is A penguin uses sleek, smooth belly feathers to slide on ice
The eight one is Digging holes and tunnels for food
Explanation:
I answered these on the most logical reasons. I did not search these up anyways if im wrong tell me the ones that were wrong.
The cortical regions indicated by E are involved in which functions?
A. The production and interpretation of language.
B. The storage of motor patterns for skilled movements of skeletal muscles.
C. The generation of emotional responses.
D. The control centers for homeostatic and endocrine functions.
The cortical areas indicated by E are involved in the functions of the production and interpretation of language.
The true choice is A.
The most important part of the brain in language activities is the cerebrum. The part of the cerebrum that is directly involved in language processing is the cerebral cortex. The cerebral cortex is the part that looks like white lumps and is the largest part of the human brain system. This section regulates or manages cognitive processes in humans, and one of them, of course, is language.
The cerebral cortex consists of two parts, namely the left hemisphere and the right hemisphere. The right hemisphere controls the processing of spatial and visual information (seeing, coloring, or perceiving spaces or objects in three dimensions). While the left hemisphere controls language activities besides, of course, other cognitive processes. Coordination between the two is possible because of the structure that identifies these two parties, namely the corpus callosum.
This question is accompanied by an image.
Learn more about the brain works in the process of language at https://brainly.com/question/12423054
#SPJ4
The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biospheres
Answer:
D
Explanation: Biospheres
HELP! Some organisms like squirrels will give a warning call if a predator is near. Why do squirrels do this if they threaten their own existence?
Answer:
This can help the group to avoid danger and increase their chances of survival. While giving a warning call may put the individual squirrel at risk, the benefits of warning the rest of the group can outweigh this cost. Additionally, some research has suggested that animals that give warning calls are less likely to be targeted by predators, as the calls can alert the predator to the presence of the group and make it more difficult for the predator to catch any individual member of the group. Overall, giving warning calls can be an effective strategy for increasing the survival chances of the group as a whole.
The basic elements of the nervous system are called Multiple Choice erythrocytes. neurotransmitters. neurons. neutrophils.
The basic elements of the nervous system are called neurons (Option C).
What are the neuron cells of the nervous system?The neuron cells of the nervous system are the most important cells of this organ system which are responsible for receiving and sending messages to the brain and thus transducing the signals from the surrounding environment
These cells (the neuron cells of the nervous system) are also known as nerve cells due to their relative importance in this organ system and s they receive sensory signals from the surrounding conditions and also motor executive functions to the muscle cells.
Therefore, with this data, we can see that the neuron cells of the nervous system are the most important cells of the nervous system whose main function is to transmit messages from the surrounding input environment to functions that are processed into the brain.
Learn more about the neuron cells here:
https://brainly.com/question/13061744
#SPJ1
HELP IM ON LIMITED TIME
During photosynthesis, plants convert sunlight into what substance to be used for energy?
Select one:
iron sulfide
carbon dioxide
oxygen
glucose
glucose is the answer because that causes energy
Answer:
The correct answer is glucose. During photosynthesis, plants use sunlight to convert carbon dioxide and water into oxygen and glucose, which is used for energy. Glucose is a simple sugar molecule that can be used by plants and animals for energy.
jpshindell13
Explanation:
The life supporting zone of the earth is *
A) Lithosphere
B) Hydrosphere
C) Atmosphere
D) Biosphere
Answer:
The correct answer is D) Biosphere. The biosphere is the part of the earth that supports life. It includes all of the living organisms on earth, as well as the air, water, and soil that they depend on. The lithosphere, hydrosphere, and atmosphere are also important parts of the earth, but they do not directly support life in the same way that the biosphere does.
Explanation:
What is the overall net gain of ATP in aerobic respiration per one molecule of glucose?
between 0-10
between 10-20
between 30-40
between 40-50
Overall net gain of ATP in aerobic respiration per one molecule of glucose is between 30-40.
What do you mean by aerobic respiration?Aerobic respiration is the process of cellular respiration that takes place in the presence of oxygen gas to produce energy from food.
During aerobic cellular respiration, glucose reacts with oxygen, forming ATP that can be used by the cell. Carbon dioxide and water are created as byproducts.
Aerobic respiration provides energy to fuel all cellular processes. The reactions produce ATP, which is then used to power other life-sustaining functions, including growth, repair, and maintenance.
Learn more about aerobic respiration:
https://brainly.com/question/12605249
#SPJ1
In dogs, gums can be pink - P (dominant), black- B (dominant), and pink with black spots. Write the genotypes for the following phenotypes .
A student wanted to find out how temperature might affect the germination of seeds.
(1) What is the variable that should be changed?
(2) What is the variable that should be measured?
(3) What are the 3 important variables that should be kept constant?
Answer:
(1) The variable that should be changed is the temperature.
(2) The variable that should be measured is the germination rate of the seeds.
(3) The 3 important variables that should be kept constant are the type of seeds, the amount of water, and the amount of light. In order to isolate the effect of temperature on seed germination, it is important to keep these other variables constant so that they do not affect the results of the experiment.
PRETTY PLEASE ANSWER BY TONIGHT, THANK YOU! : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.
Result of F1 cross:
Genotypes of F2 offspring would be 1 TTRR, 2 TTRW, 2 TtRR, 4 TtRW, 1 TTWW, 2 TtWW, 1 ttRR, 2 ttRW, and 1 ttWW
The phenotypes of F2 offspring would be tall and red-flowered, tall and white-flowered, tall and pink-flowered, short and red-flowered, short and white-flowered, and short and pink-flowered.
Dihybrid crossingThe cross is between two TtRW plants. The height (Tt) exhibits simple dominance/recessiveness while the color (RW) exhibits incomplete dominance.
TtRW gametes: TR, TW, tR, and tW
Crossing two TtRW:
TtRW x TtRW
Offspring genotype and phenotype
1 TTRR: tall, red-flowered2 TTRW: tall, pink-flowered2 TtRR: tall, red-flowered4 TtRW: tall, pink-flowered1 TTWW: tall, white-flowered2 TtWW: tall, white-flowered1 ttRR: short, red-flowered2 ttRW: short, pink-flowered1 ttWW: short, white-floweredMore on dihybrid crosses can be found here: https://brainly.com/question/1185199
#SPJ1
Mutational signatures of p53 are shown in the figure (G.P. Pfeifer et al., Nature, 21(48), 2002) for the three types of cancer with the highest death rates in the United States: lung (~225,000 deaths in 2016), breast (246,000), and colorectal (381,000).
As shown under each graph in the figure, particular transversions (replacement of a pyrimidine by a purine of vice versa) or transitions (replacement of a purine or pyrimidine by the alternative purine or pyrimidine) are features of specific mutational signatures.
Based on these data, identify the transversion or transition that seems to be induced by cigarette smoke.
The transversion or transition that seems to be induced by cigarette smoke is due to tranversions.
What is the result of mutation?A mutation has been known as the result of the changes in the structure of a gene, these variations would be happened in the nucleotide sequence of the genome, and it can be as the consequence of DNA damage.
One type of the DNA mutation has the substitution of one base pair for another. Two type of the substitutions that could be happened. One of them are the transversions, which are interchanges of a purine (A or G) for a pyrimidine (C or T) and vice versa.
Therefore, The transversion or transition that seems to be induced by cigarette smoke is due to tranversions.
Learn more about tranversions on:
https://brainly.com/question/14314137
#SPJ1
I WILL LOVE YOU FOREVER IF YOU ANSWER THIS TONIGHT : Tall red-flowered plants are crossed with short white-flowered plants. The resulting F1 generation consists of all tall pink-flowered plants. Assuming that height is a simple case of dominance and flower color involved incomplete dominance, determine the results of an F1 cross of TtRW plants. Determine the gametes, then using a Punnett square, find the genotypes and phenotypes of the F2 generation.
When the dihybrid cross is made between two TtRW plants, then the ratio of genotype produced from this cross will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).
What is inheritance?
Inheritance is the process through which genetic information is passed on from the parents to their offspring. This is possible through the gametes which fuse together to form zygote (2n). This zygote have similar characteristics to both of the parents.
In mendelian inheritance, complete dominance is observed which states that an allele could be completely dominant or completely recessive there is no in between.
However, some exceptions like incomplete dominance and codominance have been found later where, the presence of two contrasting alleles will lead to development of a phenotype which is in between the two.
In the F2 generation of the cross between the TtRW plants. The phenotype ratio will be 3:6:3:1:2:1 (tall red: tall pink: tall white: dwarf red: dwarf pink: dwarf white).
Learn more about Dominance here:
https://brainly.com/question/14053639
#SPJ1
A 163163 square-kilometer (km2km2) small island is found 2,000km2,000km from the mainland. A second, larger, 230,000km2230,000km2 island is found 1,000km1,000km from the mainland. Based on the theory of island biogeography, which of the following statements is most likely true about the small island when compared with the large island?
Based on the theory of island biogeography, the statement that is most likely true about small islands when compared to large islands is that the rate of immigration is lower for small islands than for large islands.
Island theory of biogeography explains differences in species diversity based on island size (for example, large islands tend to have more of a given species category than small islands). This means that the number of species found on an island will be determined by the area of the island.
Island biogeography theory says that small and distant islands support fewer species (types) than large islands close to the mainland. Island occupancy will be a balance of two things:
Colonization of islands by immigrant species. The colonization rate will be high if the island is located near the mainland.The extinction of species on the island. The extinction rate will be higher on a small island because the population is limited, so if a disease becomes a pandemic, the chance of extinction is high. Thus, large islands will have more species, and small islands few species.The question is multiple choice:
A. The rate of immigration is lower for the small island than for the large island.B. The small island has niches that are more like the mainland than the large island.C. The small island has more available resources than the large island.D. The rate of species extinction is lower on the small island than on the large island.Learn more about island biogeography theory at https://brainly.com/question/30027682
#SPJ4
1. Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule _________. Aerobic respiration requires the presence of Oxygen___________ and releases water and _________________ as waste products.
Answer:
Cellular respiration is a series of chemical reactions that convert the energy in food molecules into energy stored in the molecule ATP. Aerobic respiration requires the presence of Oxygen and releases water and carbon dioxide as waste products.
Explanation:
we have learned that reliance on culture has increased in the course of human history. yet the fact and mechanisms of evolution remain a key part of our human present and future because
The reason behind fact and mechanisms of evolution remain a key part of our human present and future is because c) people have not stopped adapting biologically. So, correct option is c
When an animal varieties is adequately dependent on gaining from others for at any rate a few parts of its conduct collection, social developmental cycles can emerge, and these cycles can modify the climate looked by regular determination following up on qualities.
To foster models of social development, we start by taking the hypothetically grounded and exactly tried speculations about our gaining brain science — who individuals gain from and what they will generally deduce while learning — to build models that look at what happens when bunches of people are learning in these ways, and communicating over ages.
On account of their devotion and recurrence of purpose, human social abilities to learn are most likely one of a kind in leading to combined social development, the cycle through which learning collects fruitful changes and fortunate blunders over ages
Hence, correct option is c
To know more about culture, visit here:
https://brainly.com/question/12678729
#SPJ4
(Complete question) is:
We have learned that reliance on culture has increased in the course of human history. Yet the fact and mechanisms of evolution remain a key part of our human present and future because
A.
they provide the clues to building a better human race by promoting directed speciation.
B.
the pace of evolution has been continuously increasing, as human cultural solutions have not been able to keep up with environmental changes such as global warming.
C.
people haven't stopped adapting biologically.
D.
they continue to justify anthropology's biocultural perspective.
E.
they determine, at the genetic level, our phenotype.
4. Name one thing that might affect section B of the graph above.
5. Justify your reasoning for how it will affect that section.
One thing that can affect the section B in the given graph is Human greed.
What is exponential growth?When a population's per capita growth rate remains constant, regardless of population size, exponential growth occurs, causing the population to grow exponentially as the population increases.
Many seal populations are declining as a result of human avarice. Millions of seals were slaughtered in the past for their pricey meat, fat, and fur.
Because seals are blamed by fishermen for the loss in fish stocks, seals are still murdered in huge numbers in several nations.
Thus, this can affect section B of the graph.
For more details regarding exponential growth, visit:
https://brainly.com/question/12490064
#SPJ1
Give the % yield if 1.78 g of O₂ is produced
%Yield =
Actual Yield/
Theoretical Yield x 100%
%Yield = _________x 100%.
= ____?______ %
a) The mass of the oxygen is 1.97 g
b) The percent yield is 90.4 %
c) The mass of the oxygen is 1.55 g
What is the percent yield?We know that the percent yield has to do with the amount of the reactants that has been converted into products in the given reaction. In this case, the reaction that we are dealing with is the decomposition of the potassium oxo chlorate V molecule.
Now we have that;
a) Number of moles of the chlorate = 5 g/122.5 g/mol
= 0.041 moles
If 2 moles of the chlorate produces 3 moles of the oxygen
0.041 moles of the chlorate produces 3 moles * 0.041 moles/ 2 moles
= 0.0615 moles
Mass of the oxygen produced = 0.0615 moles * 32 g/mol
= 1.97 g
b) Percent yield = Actual/Theoretical * 100/1
= 1.78/1.97 * 100/1
= 90.4 %
c) For a percent yield of 78.5% =
Actual = Percent yield * Theoretical /100
= 78.5 * 1.97/100
= 1.55 g
Learn more about theoretical yield:https://brainly.com/question/14966377
#SPJ1
% yield = (1.78 g / theoretical yield) × 100%
To calculate the percent yield, you need to know the actual yield and the theoretical yield of the reaction.
In this case, the actual yield is given as 1.78 g of O₂. The theoretical yield represents the maximum amount of product that can be obtained under ideal conditions.
To calculate the theoretical yield, you need to know the balanced chemical equation for the reaction. Assuming the reaction is complete, the coefficients of the balanced equation can be used to determine the stoichiometry of the reaction.
For example, if the balanced equation is:
2 A + 3 B → 4 C + 2 D
Then, you can use the stoichiometry to find the theoretical yield. Let's say the molar mass of O₂ is 32 g/mol. In this case, we need to calculate the moles of O₂ using the given mass of 1.78 g:
moles of O₂ = mass of O₂ / molar mass of O₂
Next, we need to use the stoichiometry to find the moles of the desired product. Let's assume that O₂ is the limiting reactant and that it is completely converted to the product. From the balanced equation, we can see that 4 moles of C are produced for every 2 moles of O₂:
moles of C = moles of O₂ × (4 moles of C / 2 moles of O₂)
Now that we have the moles of C, we can calculate the theoretical yield of C in grams by multiplying the moles by the molar mass of C.
theoretical yield of C = moles of C × molar mass of C
Finally, we can calculate the percent yield using the formula:
% yield = (actual yield / theoretical yield) × 100%
Substituting the values we calculated:
% yield = (1.78 g / theoretical yield) × 100%
Please note that without the balanced chemical equation and additional information, it is not possible to provide a specific numerical answer for the percent yield.
To learn more about yield, refer below:
https://brainly.com/question/30081101
#SPJ11
rank the following cells and particles in order according to size, with the smallest at the top and largest at the bottom.
The rank of particles in order according to size, with the smallest at the top and the largest at the bottom:
1. Protein
2. T2 bacteriophage
3. Influenza virus
4. E. coli bacterium
5. Eukaryotic cell
Protein- 3-6 nm, Proteins are in charge of nearly every aspect of cellular life, including the internal organization and shape of cells, the production of products, the removal of waste, and routine maintenance.
T2 bacteriophage- 60 nm, Enterobacteria phage T2 is a virus that infects and kills E. coli. It belongs to the family Myoviridae and the genus Tequatrovirus.
Influenza virus- 60 to 160 nm, An infection of the respiratory system's nose, throat, and lungs is known as the flu (influenza).
E. coli bacterium- 2000 nm, A Gram-negative, facultatively anaerobic, rod-shaped coliform bacterium belonging to the genus Escherichia.
Eukaryotic cell- 10,000 nm, eukaryote, any cell or organism with a distinct nucleus. The eukaryotic cell has an atomic layer.
Know more about bacteriophage here: https://brainly.com/question/29409301
#SPJ4
(complete question)
rank the following cells and particles in order according to size, with the smallest at the top and the largest at the bottom.
E. coli bacterium, Eukaryotic cell, T2 bacteriophage, Protein, Influenza virus
Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?
Anwser: Methionine-Proline-Glutamate.
The chain of amino acids would be produced by the given sequence of mRNA is as follows:
Tyr-Tyr-Ala, Val-Asn-Cys. What do you mean by Amino acids?Amino acids may be defined as the building blocks or monomers of proteins. They usually consist of an amino group, a carboxyl group, a hydrogen atom, and a distinctive side chain. These monomers are held together by peptide bonds in order to make a protein.
The codon UAU codes for the amino acid tyrosine. While the codon GCC codes for the amino acid alanine. There are three stop codons that terminate the synthesis of proteins. They are UAA, UGA, and UAG. While the codons GUG, AAU, and UGC encode for valine, asparagine, and cysteine.
Therefore, the chain of amino acids would be produced by the given sequence of mRNA is well described above.
To learn more about Amino acids, refer to the link:
https://brainly.com/question/14351754
#SPJ2
review the relationship between genotypes and phenotypes by clicking and dragging the labels to the correct location to correctly complete each statement.
Genotype alludes to the alleles you have for a specific quality or set of qualities. phenotype is the actual quality itself, which might be affected by genotype and natural variables.
The term "phenotype" alludes to the detectable actual properties of a life form; these incorporate the organic entity's appearance, improvement, and conduct. An organic entity's not entirely set in stone by its genotype, which is the arrangement of qualities the living being conveys, as well as by natural impacts upon these qualities.
A singular's genotype is the blend of alleles that they have for a particular quality. A singular's aggregate is the mix of perceptible attributes or qualities. While a living being's genotype is straightforwardly acquired from its folks, the phenotype is just impacted by the genotype.
To learn more about genotypes and phenotypes here
https://brainly.com/question/20730322
#SPJ4
From the list below, select ALL of the structures that are part of the sexual life cycle of Basidiomycota. [Do not select any structures that are part of asexual reproduction.) Conidia Ascospore Basidiospore Zygospore Rhizopus sporangium Conidiospore Ascus Basidium
Basidiospore, Basidium, Ascus are the structures that are part of the sexual life cycle of Basidiomycota.
Basidiomycota are a group of fungi that reproduce sexually through a process called basidiomycetous reproduction. In this process, the fungi produce special reproductive structures called basidia, which are located on the surface of the fruiting body (also known as the basidiocarp). The basidia contain special cells called basidiospores, which are released when the basidia mature and burst. The basidiospores are then carried away by wind or other means and can germinate to form new fungal cells. The process of basidiomycetous reproduction also involves the formation of asci, which are special cells that contain ascospores. These ascospores are produced through meiosis and can give rise to new fungal cells when they germinate. The structures listed above that are NOT part of the sexual life cycle of Basidiomycota include conidia, conidiospores, zygospores, and rhizopus sporangium, which are all involved in asexual reproduction.
To know more about ascospore
https://brainly.com/question/15047851
#SPJ4
More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause
A sharp increase in capillary hydrostatic pressure would directly cause an increase in fluid movement to the interstitial spaces.
Capillary hypertension causes the production of a protein-poor ultrafiltrate, which when it enters the interstitial space increases the amount of the interstitial fluid.
A rise in small artery, arteriolar, or venous pressure raises capillary hydrostatic pressure, which favors filtration. Fluid filtration will be reduced if the hydrostatic pressure gradient (PC - Pi) reduces due to an increase in interstitial pressure. Large rises in tissue interstitial pressure, on the other hand, can cause tissue damage and cellular death.
Edema occurs when plasma oncotic pressure falls, hydrostatic pressure rises, capillary permeability rises, or a combination of these variables occurs. When lymphatic flow is impeded, edema can develop.
For more information on capillary hydrostatic pressure, visit :
https://brainly.com/question/28274088
#SPJ4
Name the main layers of a tropical rain forest. What kinds of plants grow in each
layer?
Answer:
Most rainforests are structured in four layers: emergent, canopy, understory, and forest floor.
If you did an experimental cross and it got 1152 individual offspring how many of those offspring would have to be yellow to have a 3 to 1 yellow to green ratio from the cross
Answer: 864 yellow 288 green
Explanation:
What is the name of the signaling molecules used in endocrine signaling?
Answer:
The signaling molecules used in endocrine signaling are called hormones. Hormones are chemical messengers that are produced by glands in the endocrine system and released into the bloodstream, where they can circulate throughout the body and regulate the function of various organs and tissues. Some examples of hormones include insulin, thyroid hormone, and estrogen.
Explanation:
which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. which one of the following statements is correct? a dna cut into two pieces, leaving short regions of single-stranded dna at the ends. if a restriction enzyme is combined with a piece of dna that contains its restriction site, the result will be restriction fragments. if a restriction site is cut with a restriction fragment, the results will be multiple restriction enzymes. if a restriction fragment is cut with a restriction enzyme, even more restriction fragments will be produced. if a restriction enzyme is cut at its restriction site, the result is one or more restriction fragments.
The restriction enzymes when combined with the DNA containing restriction sites lead to cuts at those sites yielding restriction fragments. The second statement is correct.
The restriction enzymes are the enzymes that recognize specific sites known as restriction sites. These are enzymes that are found in bacteria and this feature is used as a modern biotechnology tool for genetic editing.
There are two ways the ends are formed after the action of a restriction enzyme. It can form blunt ends or sticky ends. The sticky ends have a region at the end that is single-stranded. This region can then join according to the complementary base pairing with another strand having complementary sticky ends.
If it is assumed that the RE (restriction) enzyme is not interrupted during the generation of restriction fragments, the resulting restriction fragments would not yield more restriction fragments when re-incubated with the RE enzyme.
A restriction enzyme cuts only at restriction sites forming restriction fragments that do not yield more restriction fragments on subsequent action of the restriction enzyme.
In conclusion, the action of restriction enzymes on DNA gives smaller fragments of DNA. The second option is correct.
Learn more about restriction enzymes here:
https://brainly.com/question/28197487
#SPJ12
Angelman syndrome is caused by a mutation in a paternally imprinted gene on chromosome 15. Which of the following statements is true? Select all that apply. Deletion of the paternal gene copy (but normal maternal copy) could produce the syndrome Children of affected females have a 50% chance of showing the syndrome Meiotic nondisjunction of a normal paternal chromosome 15 accompanied by loss of a normal maternal chromosome 15 in a zygote could produce the syndrome Meiotic nondisjunction of a normal maternal chromosome 15 accompanied by loss of a normal paternal chromosome 15 in a zygote could produce the syndrome Children of affected males have a 50% chance of showing the syndrome Deletion of the maternal gene copy (but normal paternal copy) could produce the syndrome
The following statements are true for the production of Angelman syndrome:
2. Children of affected females have a 50% chance.
3. Meiotic nondisjunction of a normal paternal chromosome 15 accompanied by loss of a normal maternal chromosome 15
6. Deletion of the maternal gene copy
The mutated or missing maternal copy of a portion of chromosome 15 causes Angelman syndrome. Most of the time, it is because of the gene UBE3A, which is on chromosome 15 at the 15q11 to 15q13 locus. It encodes the ubiquitin protein, which is necessary for the electron transport chain and various functions of the cell membrane.
In most cases, this father-inherited gene is deactivated in the cortex, thalamus, and hippocampus of the brain. In these regions, the only source of genetic information for ubiquitin synthesis is the maternal gene. Therefore, neurological symptoms result from any mutation or deletion of this gene or a portion of chromosome 15 in the maternal gamete. The offspring are unaffected by mutations in the paternal gamete.
know more about Angelman syndrome here: https://brainly.com/question/10485304
#SPJ4
what is the meaning of eliminated
Answer:
completely remove or get rid of (something)
Answer:
the act of considering and rejecting each possible choice until only one is left or removing soming. for example in squid games everyone got killed/eliminated at the end but ONLY ONE won.
research on aging suggests that as cells age, their rate of cell division decreases until they ultimately no longer divide. which of the following would provide evidence that the decreased rate of cell division is a cellular response related to cell signaling? decreased numbers of cytoplasmic ribosomes decreased affinity of growth factor receptors for their respective ligands decreased hormone production in aged cells decreased atp production in aged cells
The statement which provides evidence about the decreased rate of cell division is B)Decreased affinity of growth factor receptors for their respective ligands. So, correct option is B.
In each of the 4 tissues, there was a critical decline in cell division rates with age. Conversely, cell division rates didn't diminish in that frame of mind of matured mice, and just little abatements were seen in their small digestive tract or throat. These outcomes have significant ramifications for grasping the connection between ordinary undeveloped cells, maturing, and disease. Besides, they give a conceivable clarification to the baffling age-subordinate deceleration in disease frequency in exceptionally old people however not in mice.
Another assessment of recently distributed information recommended to us that the amassing of changes could slow, as opposed to increment, as people age. To make sense of this surprising finding, we estimated that ordinary undifferentiated cell division rates could diminish as we age. To test this speculation, we assessed cell division rates in the epithelium of human colonic, duodenal, esophageal, and back ethmoid sinonasal tissues.
Hence, correct option is B.
To know more about cell division, visit here:
https://brainly.com/question/29773280
#SPJ4
(Complete question) is:
Research on aging suggests that as cells age, their rate of cell division decreases until they ultimately no longer divide. Which of the following would provide evidence that the decreased rate of cell division is a cellular response related to cell signaling?
A. Decreased numbers of cytoplasmic ribosomes
B. Decreased affinity of growth factor receptors for their respective ligands
C. Decreased hormone production in aged cells
D. Decreased ATP production in aged cells
During Charles Darwin’s first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology. What evidence did he present? What did he describe as the “key” to the
formation of mountains?
He found fossils in top where it should be miles below.
Charles Darwin’s describe a lot of time as the key to the
formation of mountains.
Who is Charles Darwin?
Charles Darwin was an English naturalist, geologist, and biologist, widely known for his contributions to evolutionary biology.
Charles Darwin proposed that all species of life have descended from a common ancestor is now generally accepted and considered a fundamental concept in science.
Charles Darwin first presentation following his voyage on the HMS Beagle, he attempts to document his evidence of gradualism – an idea he learned about from reading Charles Lyell’s book Principles of Geology found fossils in top where it should be miles below. So he concluded that a lot of time as the key to the formation of mountains.
Learn more about Charles Darwin at:
https://brainly.com/question/1279802
#SPJ1