A leafy sea dragon's enzyme is being made in a cell.
Which two codons represent the amino acid phenylalanine?
A- UUU and UUC
B-AAU and UCC
C-UUA and UUG
D AUU and UUA

Answers

Answer 1

Answer:

UUU and UUC is the correct one.

Answer 2

Answer:

The correct answer is A-UUU and UUC

Explanation:


Related Questions

what type of inheritance do two alleles have if their traits blend together?

Answers

Answer:

Explanation:

Codominance is when both dominant traits are expressed, therefore if white was considered dominant and red was also a dominant trait, the petals would have spots of white and red, with no pink. Polygenic inheritance is described by one characteristic influenced by multiple genes, which is not the case in this problem.

how does the plasma membrane contribute to the structure and function of the cell?

Answers

Answer:

The plasma membrane, also called the cell membrane, is the membrane found in all cells that separates the interior of the cell from the outside environment. ... The plasma membrane consists of a lipid bilayer that is semipermeable. The plasma membrane regulates the transport of materials entering and exiting the cell.

A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it moves hazardous materials out of the cell and carries nutrients into the cell.

What is a cell membrane?

All cells' interiors are protected from the outside world by a biological membrane called the cell membrane. A cell is protected by its cell membrane, also known as the plasma membrane. Additionally, it maintains a constant environment inside the cell, and that membrane serves a variety of purposes. One is to move substances out of the cell that are toxic as well as nutrients into the cell.

Glycerophospholipids, molecules made of glycerol, a phosphate group, and two fatty acid chains, are what make up cellular membranes, including plasma membranes and internal membranes.

Learn more about cell membrane, here:

https://brainly.com/question/13524386

#SPJ5

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

which statement is true about the nitrogen bases in dna and rna?

Answers

Explanation:

in DNA nitrogen bases are adenine, thymine, guanine and cytosine and in RNA nitrogen bases are same but instead of the thymine there's uracil

in DNA there are linked together adenine and thymine ; Guanine and cytosine. And in RNA adenine and uracil; Guanine and cytosine.

The cell membrane is said to be semipermeable because

Answers

Answer:

The membrane is selectively permeable because substances do not cross it indiscriminately.

Explanation:

what kind of energy is necessary to initiate the process of photosynthesis?

Answers

Answer:

Light energy.

light energy or radiation

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

where are the proteins of the electron transport chain located in a eukaryotic cell?

Answers

Answer:

In eukaryotes, the electron transport chain is located in the inner mitochondrial membrane. In prokaryotes, it is located within the plasma membrane

A bar graph and a pie graph are the same thing.

A. True
or
B. False​

Answers

Falseee !!! I'm suree
B. False
Pie charts show how much each category represents as a proportion of the whole and Bar graphs use a series of rectangular bars to show absolute values or proportions for each of the categories

Kim's Dalmatian, Tigger, always eats the same brand of food. Although he does everything else at lighting speed, he is a very slow eater. After watching a TV commercial touting the irresistible taste of Puppy Yums Dog Vittles, Kim decides to conduct an experiment comparing Tigger's regular food (K-9 Crunchy Bits), Puppy Yums Dog Vittles, and a store brand that cost 1/3 as much as the advertised food. Kim gave Tigger the same quantity of each different food, on three successive evenings, and used a stopwatch to determine Tigger's dinner-time munching speed.

Hypothesis:
Predicted Results:
Independent Variable:
Dependent Variable:
Control Variable:

Answers

The experiment was intended to show that the dog will eat the tastier food advertised on TV at a faster rate than it eats its regular food.

An experiment must have an independent variable and a dependent variable. The dependent variable is the variable that is being manipulated in the experiment. The responding variable is also called the dependent variable.

In this experiment;

The independent variable is the type of dog foodThe dependent variable is the eating time of the dogThe predicted result is that the dog will eat the advertised Puppy Yums Dog Vittles faster than the other dog foodsThe control variable is the quantity of dog food given to the dog each evening.The hypothesis of the experiment is that the dog will eat the advertised tasty food faster than it eats its regular food.

Learn more: https://brainly.com/question/22824409

which term describes the ability of neurons to process information, store and recall it, and make decisions?

Answers

Answer:

Neural Integration

Explanation:

:)

A person who is exercising vigorously breathes more deeply and rapidly than someone who is resting. Give TWO reasons why this is necessary.

Answers

During physical exercise, more oxygen is used up and more carbon dioxide is produced leading to faster and deeper breathing.

Physical exercise is a state in which the muscles are flexed much vigorously leading to a faster heartbeat owing to a quicker rate of pumping of the blood by the heart.

There are two main reasons why a person engaging in physical exercise tends to breathe faster and more deeply;

The muscles tend to work harder during physical exercise hence more carbon dioxide is produced.The body uses up oxygen more quickly leading to a greater demand for oxygen and thus a faster and heavier breathing rate results.

Learn more about physical exercise: https://brainly.com/question/1080637

GUYS PLEASE HELP I HAVE SCHOOL TOMORROW AND THIS IS THE LAST QUESTION BEFORE I GET TO GO TO A HAUNTED HOUSE XD.
When a cell uses a ____ channel to get large molecules across the cell membrane this is known as ___ diffusion.
That's all it gives me two answers please. *PLEASE HELP*

Answers

Answer:

I'm pretty sure the bottom one is faciliated diffusion. Try searching up your answer so sorry I couldn't help more, but I hope that does help you out a bit:)

easy - one giving brainly if correct AND DETAILED!
please give me at least 2.​

Answers

Well you see theres this guy named MrBeast thats taking little kids money and is having one of his slaves eat a water bottle for every dollar

Answer:

Well recently Team Seas has come out for every dollar donated I think it's 1 pound of trash so by donating would be one.

The second would be volunteering to help clean up for example a beach.

For more lasting impact would be to have a machine that collects the trash at where the rivers and streams meet the ocean this will lead to less trash in the ocean. There is a great example of this machine by Mark Rober gives a detailed explanation.

can someone summarize this for me


“summarize the information to demonstrate that you understand the concept of negative feedback “

Answers

Answer:

Short paragraph:

Homeostatis is the process by which the body maintains a stable internal environment. The hypothalamus is a part of the brain that regulates many key body processes. It works to restore the system to its normal state when an internal change in one of these systems occurs.

Long paragraph:

The hypothalamus is a part of the brain that regulates many key body processes including internal body temperature, hunger, thirst, blood pressure, and daily (circadian) rhythms. When the brain receives signals from the body about an internal change in one of its systems, it works to restore the system to its normal state. For example, the normal internal temperature for the human body is approximately 98.6 degrees Fahrenheit. If the body temperature rises because of exercise, the body will try and cool itself off. This happens through coordination between the hypothalamus and the various body systems that are affected.

5. What natural phenomenon converts nitrogen into the form which organisms can use?

Answers

Answer:

the nitrogen cycle

Explanation:


Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?

Answers

Answer:

water will move out of the cell,energy is required

Explanation:

water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.

The following are the results of a genotype being "foiled" for a dihybrid cross: BS, Bs, bS, bs.

Determine the parents' genotype
A. BbSS
B. BBss
C. BsSs
D. BBSS

Answers

Answer:

C.

Explanation:

When two substances create a solution, what happens to its mass?
A.The mass is increased.
B.The mass is decreased.
C.The mass stays the same.
D.The mass disappears.

Answers

The mass is increased becuase you are adding two substances together, you are adding their individual masses together

Tại sao con người chúng ta lại sốt nhiều lần như vậy?

Answers

Answer:

Fever is an elevated temperature of the human body that is substantially beyond the normal range. Normal body temperature fluctuates daily from about one degree below 98.6 degrees Fahrenheit to one degree above that number. Lower body temperatures usually occur before dawn; higher temperatures in the afternoon.

Body temperature also varies slightly depending on where on the human body it is measured. Rectal (internal) temperature tends normally to be higher than skin (surface) temperature. Oral and armpit temperatures can approximate actual body temperature and are more convenient to measure.

Why are chromosomes arranged in homologous pairs in meiosis

Answers

Answer:

They allow for the recombination and random segregation of genetic material from the mother and father into new cells.

Explanation:

WHAT ARE THE IMPORTANCE OF TRANSPORT MECHANISMS IN CELLULAR PROCESSES?

Answers

To protect the cells internal environment and balance the nutrients and proteins that keep the cell alive

Which best describes an advantage of this type of reproduction?
А.
It allows for fast reproduction.
B
It introduces genetic variation.
с
It does not require any energy.
D
It prevents mutations from occurring.

Answers

I think answer is D- because when the cell breaks in half it’s not recreating it’s full self and also preventing mutations from happening

What bird is known in North America that makes domes shaped nests and lives in the western part of it?

Answers

Answer: Cowbirds lay eggs in a great variety of nests, including Red-winged Blackbird nests in marshes, dome-shaped Ovenbird nests on the forest floor, cup nests in shrubs and treetops, and even occasionally in nests in tree cavities.

Type your response in the box.
Do you think one gene controls human hair color? Explain your answer.

Answers

Do you think one gene controls human hair color?

No, this is false. Not only one gene is responsible for the colour of your hair, at least 2 gene pairs control human hair colour. Therefore, this is wrong since each parent contributes multiple hair-colour genes .

Hope this helped you, have a good day bro cya)

Answer:

There are many different phenotypes for hair color among humans. Therefore, multiple genes control hair color.

What happens to this enzyme when the pH rises above 12?

I'll give you brainliest if you answer correctly

Answers

Answer

Enzymes are also sensitive to pH . Changing the pH of its surroundings will also change the shape of the active site of an enzyme.

74 POINTS!!!!!!!!
Do you think we should attempt to
quantify and assign market values
to ecosystem services and other
entities that have only non-market
values? Why or why not?

Answers

Answer:

yes

Explanation:

yes because I like the same thing cuz you just like doing like what you have to do and I did it already and I got it a

the hershey and chase blender experiment was designed to

Answers

Answer:

Hershey and chase sought to determine if the replicating piece of phages that entered bacteria during infection, the genetic parts, were solely DNA.

Explanation:

which muscle cells have desmosomes and gap junctions

Answers

Answer:

Cardiac muscle cells are rectangular-shaped cells connected by regions called intercalated discs. Intercalated discs contain gap junctions and desmosomes.

Explanation:

The muscle cells that have desmosomes and gap junctions are cardiac and smooth muscle cells. The correct option is C.

What is a cardiac cell?

Cardiac cells are the chain of myofibrils and look like a chain of rods. It is of red color. Cardiac muscle cell has three types of gap junction. The two types are sheet desmosomes and spot desmosomes.

The options are attached below.

Thus, the correct option is C. cardiac and smooth muscle cells.

Learn more about cardiac cell

https://brainly.com/question/14005473

#SPJ2

which could take place by active transport A. the movement of carbon dioxide into a photosynthesising leaf B. the movement of carbon dioxide out of a respiring cell C. the movement of nitrate ions into a root hair cell D. the movement of oxygen into a respiring cell

Answers

Answer is C, Hope this helps!!

Other Questions
cuales son los nombres de la distribucin de los electrones en un tomo ? The owner of a used car dealership is trying to determine if there is a relationship between the price of a used carand the number of miles it has been driven. The owner collects data for 25 cars of the same model with differentmileage and determines each car's price using a used car website. The analysis is given in the computer output.Predictor Coef SE Coef t-ratioConstant 2415712 2164.1 2.9650.046Mileage-0.181 0.024 5.3770.000s = 3860.7R-S = 68.0%R-Sq (Adi) = 69.59Using the computer output, what is the value of the coefficient of determination?00.460.68N0.700.82 HELP PLEASE!!!! I REALLY NEED HELP During the time of pandemic how Embroidery helps you become productive as a member of the family? Which of the following statements can correctly be made about the use of chemicals in theRestaurant? (Select all that apply.)A. Store chemicals in separate areas from foodB. Never hang chemicals above foodC. Measure proper concentrations of chernicalsD. Label chemicals clearly Which is the central element for all living things?carbonhydrogenoxygennitrogen Mother is in 1st period shes gonna do school and then talk to you guys after school i have practice again on Thursday from 4;30 to 6;30 love yall bye loves Avery and Carmen both have summer jobs. Avery gets paid $360 every 4 weeks. Carmen gets paid $480 every 6 weeks. summer break lasts a total of 12 weeks. who will earn more money during summer break? Find all numbers whose absolute value is 5.If there is more than one, separate them with commas.If there are no such numbers, click on "None". what country just sent three astronauts on a six-month mission to work on its new space station? What is 1/8 of 3? When i look it up it says to many different answers. Sylvie has an assignment to write a report on a pop musician from the 1980s. Who is the BEST choice for Sylvie towrite about? 1. What does the term monecious mean? Active or passive Identify whether each sentence is written in the active or passive voice. how did global networks of exchange impact chinese society in the yuan dynasty? beneficios de las clases presenciales. alguien me puede decir? ******Please help me help please help me ****** Identity which option in each of the following groups is punctuated correctly. 1. During my first three months of work, I attended three conferences, they were all required events for my training. 2. During my first three months of work, I attended three conferences: they were all required events for my training. 3. During my first three months of work, I attended three conferences; they were all required events for my training. 4. I think I would like to work at the smaller company, however the other job pays more. 5. I think I would like to work at the smaller company: however, the other job pays more.6. I think I would like to work at the smaller company; however, the other job pays more. 7. He graduated from college at the age of 17: furthermore, he earned his PhD when he was 19. 8. He graduated from college at the age of 17; furthermore, he earned his PhD when he was 19. 9. He graduated from college at the age of 17 furthermore, he earned his PhD when he was 19. 10. The following companies will be going out of business, HiTech, CyberSafe, and CalKey. 11. The following companies will be going out of business; HiTech, CyberSafe, and CalKey. 12. The following companies will be going out of business: HiTech, CyberSafe, and CalKey. How to solve this?With solutions In a short paragraph, analyze the development of the authors' claim in one of the paragraphs examined in part A. If needed, review the full text of Shoes: Feet First! Answer these questions in your response: What is the authors' claim in this paragraph? What details develop this claim in the paragraph? How does this paragraph refine the authors' overall claim in this passage?