Mathematics High School

A line passes through the points A(–1, 7) and B(1, 3). b Write an equation

Answers

Answer 1

Answer:

y=-2x+5

Step-by-step explanation:

First, find the slope:

m=(y2-y1)/(x2-x1) ==> slope formula where m is the slope

(–1, 7), (1, 3) ==> (x1=-1, y1=7), (x2=1, y2=3)

m=(3 - 7)/(1 - (-1)) ==> plugin y2=3, y1=7, x2=1, and x1=-1 into the slope formula

m=(-4)/(1 + 1) ==> simplify

m=(-4)/2

m=-2 ==> the slope is -2

y=mx+b ==> slope-intercept equation

3=(-2)(1)+b ==> plugin the slope(m=-2) and point B(1, 3) ==> (x=1, y=3)

3=-2+b ==> solve for b

3+2=-2+2+b ==> add 2 on both sides to isolate b

b=5 ==> simplify

y=-2x+5 ==> plugin the slope and b=5 into the equation

Related Questions

plz answer
correctly it is worth a lot of points

Answers

75% is covered by the shaded area.

Answer:

75%

Step-by-step explanation:

what does 96*96 equal??

Answers

pretty sure 96 * 96 = 9216 !

Help please I need help

Answers

Answer:

12=4 3 4=2 2

Step-by-step explanation:

This image shows a square pyramid.

What is the surface area of this square pyramid?

32 ft²

64 ft²

128 ft²

136 ft²

Answers

Answer:

please provide the image! would love to help.

Step-by-step explanation:

Answer:

128

Step-by-step explanation:

I took the test

What is the area of the base?

Answers

Answer:

Step-by-step explanation:

The area can be calculated by Length times width. The length is 10 and the width is 2 so 10 x 2 = 20

Cheers

Answer:

I believe it is 20

Step-by-step explanation:

10 x 2 = 20

Find 33⅓% of ⅘ of $4.50.

Answers

The answer i got was 120666.6 dollars

I hope this helps you :)

pls help me! will give brainliest

Answers

Answer: (-1, 3)

Steps
X value to the left means add
X value to the right means subtract
Y value down means subtract
Y value up means add

-1,3 is the answer y -1 x 3

Please help algebra work

Answers

Answer:

I think it is J

Step-by-step explanation:

the x-2.... so on x axis on 2....and +5 is y intercept

A bat was flying for four and a half hours at a constant speed of ten kilometers per hour. How far did the bat travel in meters?

Answers

Answer:

45000 m

Step-by-step explanation:

Speed = distance / time

10 km/h = distance / 4.5 hours

distance = 10 x 4.5 = 45 km

Kilometre needs to be converted to metres

Ikm = 1000m

45 x 1000 = 45,000m

This table shows how the cost of Dana’s birthday party depends on the number of guests. What is the price per guest?

Answers

Answer:

it would be 60

Step-by-step explanation

4*5= 20

8*5=40

12*5= 60

We multiply by 5 because if we divide 20/4=5, 40/8=5, 60/12=5.

help me pls I would aprreciate it

Answers

Answer:

Step-by-step explanation:

Can someone help me with this. Will make brainliest. Need answer and explanation/work. Thank you.

Answers

Answer:

A quadrilateral has a parallelogram if one pair of opposite sides is congruent and parallel. Parallelograms are designed to have diagonals that bisect one another. When ABCD is bisected by — BD and —AC, then ABCD is a parallelogram.

Step-by-step explanation:

Answer:

A quadrilateral has a parallelogram if one pair of opposite sides is coinciding exactly when superimposed and parallel. Parallelograms are designed to have diagonals that bisect one another. When abcd is bisected by bd and ac, then abcd is a parallelogram.

Step-by-step explanation:

What is the distance between (4,7) and (2,2)

Answers

Answer:

10.7703296142

Step-by-step explanation:

Using "Desmos" a graphing chart and the hypotenuse formula, i have found the distance diagonally from point (4,7) and (2,2)

plz answer the question and explain how you got the answer

Answers

Answer:
1,741.67 yards
Step-by-step explanation:
1 foot = 1/3 yards
5,225 divided by 3 is 1,741.67

Writing Linear Equations

Two less than five times a number x is equal to 13. Solve for x.

Answers

Answer:

x = 3

Step-by-step explanation:

5x - 2 = 13 (write the equation)

5x - 2 + 2 = 13 + 2 (isolate the variable)

5x = 15

5x/5 = 15/5 (simplify)

x = 3

Answer: x=3

Step-by-step explanation:

13=5x-2

13+2=5x

15=5x

x=15/5

x=3

Identify the set as finite or infinite
{1 1/4, 1/16, 1/64,,,}

Answers

Answer:

??????

Step-by-step explanation:

What that does not make sence at all

Which point on the number line best represents the location of 78?

F Point M
G Point N
H Point P
J Point O

Answers

Answer: F
because if you simplify 78 it’ll give you about 8.831...

What value of b will make the equation a true statement? Explain how you arrived at your solution. (−34 + 43)+ b = 0

Answers

Answer:

b = -9

Step-by-step explanation:

Given the equation (−34 + 43)+ b = 0

We are to find the value of b

First solve for the value in parenthesis

(−34 + 43)+ b = 0

9+b = 0

Subtract 9 from both sides

9+b-9 = 0 - 9

b+0 = -9

b = -9

Hence the value of b will make the equation a true statement is -9

Find area of the figure. PLEASE HELP!

Answers

Answer:

Step-by-step explanation:

Answer:

69 m²

Step-by-step explanation:

The figure is composed of 2 right triangles

The area (A) of a triangle is calculated as

A = [tex]\frac{1}{2}[/tex] bh ( b is the base and h the perpendicular height )

A of triangle on left is

A = [tex]\frac{1}{2}[/tex] × 9 × 10 = 45 m²

A of triangle on right is

A = [tex]\frac{1}{2}[/tex] × 8 × 6 = 24 m²

Total area = 45 + 24 = 69 m²

temperature in Moscow was 2 degrees Celsius then it dropped to 8 degrees Celsius below zero by how many degrees did the temperature drop

Answers

Answer:

Step-by-step explanation:

2--8

2+8

8 below zero is -8

Which list orders the numbers from least to greatest

Answers

The second line
least to greatest: -3, -2.4, -21/4, -1.5, -11/8

Solve for m angleUVW if m angle UVX = 40° and m angle XVW = 68°

Answers

Answer:

The measure of the obtuse angle marked UVW is 108

Step-by-step explanation:

Here, we want to get the measure of the angle marked UVW

To get this, we refer to the given diagram

From the diagram;

UVW = UVX + XVW

UVW = 68 + 40

UVW = 108 degrees

Does anyone know how to do this?

Answers

Answer:

7 unites

Step-by-step explanation:

PLXS HELP NEED BY TODAY

Answers

Answer:

I believe its 17, this is a 90 degree angle, so 90-73=17

Step-by-step explanation:

the degree of a right angle would be 90° so you would solve it by subtracting 90°-73°=x°
x= 17°

Can you guys help me answer question 1 and 2

Answers

For 1 the answer is A. For 2 I can’t see the choices

HELPPPPPPPPPPPPPPPPP

Answers

Answer:

I think it's 160 square inches. Try L x W x H (length multiplied by width multiplied by height). So that would mean 4 x 5 = 20 x 8 = 160,

hope this helps!

Answer:

Step-by-step explanation:

Un albañil pone azulejos a una pared de 6 m de largo y 2,4 m de alto.Los azulejos son cuadrados de 20 cm de lado

Answers

Pregunta completa:

Un albañil pone azulejos a una pared de 6 m de largo y 2,4 m de alto. Los azulejos son cuadrados de 30 cm de lado. ¿Cuants, cajas tendra que comprar si en una caja hay 25 azulejos? Con procedimiento.

Respuesta:

160 tejas

7 cajas

Explicación paso a paso:

Dimensión de la pared = 6 m por 2,4 m

Área de la pared = 6 m * 2,4 m

Área de la pared = 14,4 m²

Longitud lateral, s de teja cuadrada = 30 cm = 0,3 m

Área de la loseta cuadrada = s² = 0.3² = 0.09m²

Número de baldosas cuadradas necesarias:

14,4 m² ÷ 0,09 m²

= 160 fichas cuadradas

Si hay 25 fichas en una caja;

Número de cajas a comprar:

160/25

= 6,4 ≈ 7 cajas

What value of x would make the figure a parallelogram (show your math please)

Answers

Answer:

Step-by-step explanation:

Diagonals of a parallelogram bisects each other.

Therefore,

4x = 8

x = 8/4

x = 2

5x = 3x + 4

5x - 3x = 4

2x = 4

x = 4/2

x = 2

Help please due td!!

Answers

B.) 23

the equation set up is “ 4x+13=105 “
do -13 on both sides which would then leave you with “ 4x=92 “. then you just divide 4x on both sides, giving you the answer of 23 :D

.............Option B)

i need help with this since it’s due tomorrow, listing the side lengths of XYZ in order from smallest to largest

Answers

Answer:

∠ x , ∠ z , ∠ y

Step-by-step explanation:

Other Questions

PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy? A, B, C and D are points on the circumference of a circle, and the center is O. AC is the diameter of the circle. AC and BD intersect at E. Which point would map onto itself?