Mathematics Middle School

A restaurant manager recorded the drinks ordered by 150 customers. Each customer ordered one drink. The results are shown in the circle graph below.

How many customers ordered juice, tea or water?

A Restaurant Manager Recorded The Drinks Ordered By 150 Customers. Each Customer Ordered One Drink. The

Answers

Answer 1

Answer:

82% of people ordered juice, tea, and water

Step-by-step explanation:

Answer 2

Answer:

123 customers

Step-by-step explanation:

12%tea+30%juice+(100-12-30-18=40) 40% water=

82%

82% of 150

150*0.82

123

Related Questions

I REALLY NEED HELP WITH THIS IT HAS TO BE TURNED IN 4 MINUTES PLEASE HELP

Answers

Answer:

What can I help you with?

Step-by-step explanation:

Answer:

I would like to help but there is no question

Can someone solve this for me plsss i really need help with this no links an dno doing it just for the points need all three questions WILL GIVE BRAINLIEST

Answers

Answer:

1. m∠1 = 105 m∠2 = 75

2. x= 130

Step-by-step explanation:

1. Solved m∠2 by using 75° angle because they are the same angle

m∠1 = 180- 75°

2. 180-70= 110

(x-20)= 110

x= 130

The diameter of a circle is 20 cm.
Find the area of a semicircle.
Use a = 3.14

Answers

Answer:

157.08cm²

Step-by-step explanation:

pls brainliest

Answer:

157 cm

Explanation:

First you need to find the radius so you divide 20 by 2 (20 ÷ 2). Which will give you, our radius of 10. You take that radius and square it so 10 x 10. You will get a product of 100. Then you multiple the 100 by pi (100 x 3.14) and you will get 314. Since it's a semicircle you need to cut this 314 in half (314 ÷ 2 = 157).

Derrick goes to the store and buys a pair of shoes for $79.99, a shirt for $24.99, and a pair of shorts for $34.99. If the sales tax is 8.5%, then about how much did Derrick pay in sales tax?

HELP

Answers

Answer:

sales tax is 11.89745 round if u want

Step-by-step explanation:

i just added 8.5 percent

Please help fast, I will give brainliest to whoever does

Answers

Answer:

Ok so first, divide the figure into 2 triangles ABC and ADC

Then, find the area of triangle ABC, base being 10 (5+5) and height being 4

= 1/2 * bh

= 1/2 *  10 * 4

= 20 sq. units

For 2 triangles, 20 * 2 = 40 sq. units

The image isn’t loading for me

Evaluate e times e -5e when e=5

Answers

e(e) -5e
5(5)-5(5)
25-25= 0

The answer is 0.

Answer:

I wasn't sure for the question. that's why I posted two answers for your question.

please help I will really appreciate it. It is about unit rate!

Answers

Answer: The first one of the 180 miles the answer is 40 miles per gallon

The one of the 10 1/3 one answers is 62 miles per hour

and the $8 the answer is 9.6 U.S. dollars per hour

I hope this helped

please help i have to at least get 82% but this is a hard concept for me, giving brainlest when available

Answers

Answer:

It is 30 minutes

The answer is 30 because the middle line of the box plot is centered at 30 which is the middle/median. :)

Help pls and no links

Answers

Answer:

55

Step-by-step explanation:

First find the ratio to the second 5/1 object then multiply 5 by 11

47cm should be right

What is the circumference of a circle that has a radius of 10 in? Use 3.14 for π.

31.4 ft
62.8 ft
15.7 ft
314 ft

Answers

The circumference is 62.83in

Step-by-step explanation:

The formula to find the perimeter or circumference of a circle is P=2×π×r.

Step 1: Find the radius. In this case it is 10 in.

Step 2: Multiply the radius by 2 for simplicity. In this case 10×2=20.

Step 3: Multiply the last number by π. In this case, 20×3.14=62.8.

Step 4: You have the answer. Hope this helps!

answer plz best one gets brainlyest

Answers

15ft squared      

it is about 3 times the amount of carrots

Giving brainliest so no links
Choose the best estimate for the weight shown on the scale below.

A) 192 lb
B) 192 T
C) 197 lb
D) 197 T

Answers

The answer is A. 192 lbs

weight is measured in pounds = lbs

the scale shows 192
The answer is A 192 lb

(BRAINLIST!!!)70 POINTS!!! ASAP Write two different expressions equivalent to 8d - 4) Use factoring for one way​

Answers

Answer:

one is using commutative property 4d - 8

another is 2 to power of 4 - 2 to the power of 2

Step-by-step explanation:

help outt sum1 plzz i will mark brainliest

Answers

Answer:

27

Step-by-step explanation:

what they saidddddddd

Liz wants to buy a new cell phone. If she buys one now, it will cost $462.00. If Liz waits until her contract is over, she can upgrade to the same phone for $415.00. How much can Liz save if she waits?

Answers

Answer:

she would save $47 if she waited.

Step-by-step explanation:

She would save $47 if she waited because 462-415 is 47

Find the area of each sector.

Answers

Answer:

225

Step-by-step explanation:

360 - 135 = 225

An investor has an account with stock from two different companies. Last year, his stock in Company A was worth $1790 and his stock in Company B was worth $1000. The stock in Company A has increased 20% since last year and the stock in Company B has increased 22%. What was the total percentage increase in the investor's stock account? Round your answer to the nearest tenth (if necessary).

Answers

Answer:

20.7%

Step-by-step explanation:

Amount of stock increased in Company A = 20% of 1790

           = 0.20 * 1790 = $ 358

Investor's stock in company A this year = 1790 + 358 = $ 2148

Amount of stock increased in Company B = 22% of 1000

           = 0.22 * 1000= $ 220

Investor's stock in company B this year = 1000 + 220 = $ 1220

Total amount in investor's stock account  = 2148 + 1220 = $ 3368

Increased amount = 3368 - 2790 = $ 578

Increase percentage = [tex]\frac{578}{2790}*100[/tex] = 20.71

                                   = 20.7%

Answer:

20.7%

Step-by-step explanation:

I would like to know what part of the ax+bx=c standard equation means in a graph

Answers

The answer is C. -x^2 - 4x + 5

What does it mean when it shows this in math

Answers

The number in between the bars will always be equal to the same number, but positive. For example:
|-15| = 15

|15| = 15

|5| = 5

|-5| = 5

Write an inequality, using x as the variable, that represents this situation

Answers

Answer:

154 + 11x > 330

x > 16

Step-by-step explanation:

More than means > 330

x = per house

Equation:

154 + 11x > 330

Solving:

154 + 11x > 330

11x > 330 - 154

11x > 176

x > 16

X is higher than sixteen

Nathan found two worms in the yard and measured them with a ruler. One worm was 4/5 of an inch long. The other worm was 1/10 of an inch long. How much longer was the longer worm? Write your answer as a fraction or as a whole or mixed number.
please help and thank you even if you dont

Answers

Answer:

7/10

Step-by-step explanation:

4/5 is greater than 1/10

I converted 4/5 into 8/10 because I multipled the numerator and denominator by 2.

Then I subtracted 8/10 from 1/10 and got 7/10

A pair of designer sneakers was purchased for $120 and a few months later, the new price is $138.
what is the percentage increase?

Answers

15 percent increase
Hope that helped, you just divide the last number by the first one
its 15 (source):trust me bro

What is the volume of this cube?
Enter your answer as a decimal in the box.
m3
Will give brainlest if right

Answers

Step-by-step explanation:

Use formula for cube volume:

V=a³

Then add informations you already have and you are done.

V=0,5³

V=0,125 m³

Answer:

0.125

Step-by-step explanation:

The formula to find the volume of a cube is: V=a^3

Since we are given that one side of the cube is 0.5 m, you can take 0.5 and insert it into the formula V=a^3

V=0.5^3

V=0.125

Hope this helps ^-^

Sophie is 3.5 years younger than her brother. She knows that when she is b years old, her brother is b+3.5 years old. Right now, Sophie is 11.5 years old.
How old is Sophie's brother?
Write your answer as a whole number or decimal.

Answers

Sophie's Brother's Age : b+3.5 years old

Sophie's Age : b years old

                       = 11.5

Sophie's Brother's Age = 11.5 + 3.5

                                       = 15 years old

Hence, Sophie's brother is 15 years old.

Hope this helps :)
P.s. Can you mark me as the Brainliest? :]

In the triangle above, the measure of X is 25°, and the measure of Y is 113°. What is the measure of Z?

Answers

Answer:

D

Step-by-step explanation:

Answer:

A

Step-by-step explanation:

The sum of the 3 angles in a triangle = 180°

Subtract the sum of the 2 given angles from 180° for z , that is

∠ Z = 180° - (25 + 113)° = 180° - 138° = 42° → A

I need help w 4-7. I already have number 3 but this is a dif screenshot

Answers

Answer:

Sorry but you can read well

Step-by-step explanation:

Answer:

The answer is increased by 3%

Step-by-step explanation:

PLZZZZZZZZZZZZZZZZZ HELPPPPPPPPPPPP

Answers

Answer:

She should by 1.9 quarts

Step-by-step explanation:

The answer would be 1.9 (or 2)

First, you find the area of the window (6), and the area of the wall (120). Then, subtract those two numbers to get 114. Finally, divide 114 by 60 to get the final answer, 1.9. (Then just round up to 2)

Hope this helped!!!!

Reggie and Elena each had one cup of water during a break in the soccer game. They took the water from the same 1 -quart container. If they took two cups total from the full I-quart containerf how many ounces of water were left?

Answers

Answer: 16 ounces

Explanation:
There are 32 ounces in a quart and 8 ounces in a cup there were 2 cups taken out of the 1 quart
8x2=16
32-16= 16 ounces left in the quart

Write the formula for the parabola.

Answers

Answer:

Given the focus (h,k) and the directrix y=mx+b, the equation for a parabola is (y - mx - b)^2 / (m^2 +1) = (x - h)^2 + (y - k)^2.

Step-by-step explanation:

Can someone explain this to me?
-5 -5 -3 -3 -2 -2 -1

1. What is the mean?

2. What is the median?
3. What is the mode?
4. What is the range?

-8 -6 -4 -4 -3 -2 -1

5. What is the mean?
6. What is the median?
7. What is the mode?
8. What is the range?

Answers

1. (-4)
2. The median is the number in between the number line that is in the middle ( it goes least to greatest)(-4)
3. The mode it what number repeats ( -4)
4. The range is the subtracted greatest from the least (-1)
1. The mean is the average of those numbers. Add those numbers and divide it by how many numbers there are.
2. The median is the number in the middle. If there are two middle numbers, add those together and divide by two.
3. The mode is the number that repeats the most.
4. The range is the difference between the least and greatest number. Just take the greatest number and subtract it by the least number and you’ll have your answer.
Other Questions
Does the FCC protect consumers? How does religious conflicts affect society? Match each rhetorical appeal to its correct definition. Match Term Definition Ethos A) An appeal to emotion that may use vivid imagery, descriptions of emotional events, or emotionally charged words Logos B) An appeal to credibility, ethics, or moral principles that may use positive references to the audience's sense of right versus wrong Pathos C) An appeal to logic or reason that may use facts, statistics, and citations of valid evidence to bring an audience to a clear and logical conclusion What was the first Agricultural Revolution known as? What is iambic pentameter in sonnet? A line with a slope of 4 and passes through (2, 4) What is the equation of the line in slope intercept form (y = mx + b) ? What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by?