A skier is going down a hill at a speed of 9 m/s. The hill gets steeper and her speed increases to 18 m/s in 3 s. What is her acceleration?

Answers

Answer 1
Correct answer - 3 m/s.

Why? - Acceleration formula - V1 - V0 / T.
18 - 9 / 3
9 / 3
= 3 m/s.

Related Questions

what’s the chemical reaction for the digestion of fats.

Answers

Answer: The chemical reaction for the digestion of fats is when A triester is produced through the chemical reaction of three fatty acid molecules with glycerol, a molecule that contains three hydroxyl groups. When fats are broken down these fatty acid chains and glycerol are free for the body to use.

Explanation:

Lipids (fats and oils)

Lipase enzymes break down fat into fatty acids and glycerol. Digestion of fat in the small intestine is helped by bile, made in the liver. Bile breaks the fat into small droplets that are easier for the lipase enzymes to work on. Bile is not an enzyme.

Why is cellular differentiation
important for the development of a fully formed human infant?

Answers

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant. Without tissues and organs our body cannot function properly.

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant.

:

A primary air pollutant is put directly into air by human activity.What is a secondary air pollutant

Answers

Answer:

Acid Rain

Explanation:

Acid rain, which is made up of several acidic compounds, forms when sulfur dioxide and nitrogen dioxide react in the air with water, oxygen and other chemicals. On the ground, acid rain damages plants and trees and increases the acidity levels of soils and bodies of water, causing damage to ecosystems. Acid rain also causes decay to buildings and can irritate the eyes and airways.

2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon

Answers

Answer:

B

because iron appears the color red

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

Plz help I’ll mark brainliest

Answers

Answer:

I'm pretty sure it's exponential growth.

Explanation:

Answer:

expontential growth!!

Explanation:

Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.

Answers

Answer:

It triggers seed germination by activating hormone.

Explanation:

Karrikins has a great effect on seed  germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.

7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas

Answers

A is the correct answer.
The answer is: A gas changing into a liquid

Cell specialization is important during the growth and development of a multicellular organism. This process is most directly regulated by _____________.

Answers

Answer:

atp

Explanation:

Which mechanism of transport takes place without expending cellular energy?

Active
Hypotonic
Isotonic
Passive

Answers

Passive 123456799483762

Answer:

c

Explanation:

What type of muscle has a primary purpose of animal movement?

A) cardiac muscle
B) smooth muscle
C) tendons
D) skeletal muscle

Answers

Answer:

B. Smooth Muscle

Explanation:

Medusae are among the simplest animals that use muscles to make rhythmic movements. In at least some medusae, the circular muscles, which do most of the work of swimming, are striated. In contrast, most of the other muscles of cnidarians are smooth.

Answer:

D) skeletal muscle

Explanation:

skeletal muscle cells join together to form fascicles, and fascicles form the skeletal muscle.

Important vocabulary continued: what is the difference between a unicellular organism and a multicellular organism?

Answers

unicellular has one singular cell, multicellular has more than one

Answer:

unicellular is a organism that is only one cell. most of the time they are your bacteria and viruses. while a multicellular organism is a organism with many cells. can be anything from something you cant to to plants and animals that you can see

Explanation:

Does all human activity have a negative impact on the environment and
ecosystems? *
A:NO
B:YES

Please help for my homework

Answers

Answer:

No

Explanation:

Answer:

A. NO

Explanation:

Because it depends if the activity. negatively or positively. Because humans can be very careful of how they affect the Earth and sometimes they can't.

What are the DNA strands called?
What is the RNA stand called?

Answers

Answer:

it rna means

Ribonucleic acid

Answer:

DNA strands - polynucleotides

RNA strand - nucleotide chain

Explanation:

DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.

RNA is composed of a single nucleotide chain.

Hope this helps :)

If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? Explain what you would expect and why.

Answers

Answer:

If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? ... That the predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.

Explanation:

The predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.

What the Viceroy's color pattern evolved?

The Viceroy's color pattern has been evolved because the natural selection favoured them. The viceroy butterfly camouflage as the monarch butterfly as well as the exhibit Mullerian mimicry where as these two toxic species has the mimic each other for their benefit and by time natural selection has been favoured these.

Natural selection has been the process by which the reproductively fitest has the populations of the living organisms survive, adapt and change. The viceroy butterfly has the brush-footed butterfly having the dark orange colour with the black veins and row of the white spots on the border of its wings.

Monarch butterfly has the same as that of the viceroy except that it has the black horizontal stripes that has cross the bottom of its back wings. Species has refers to the group of the organisms which have the similar features and which are able to be interbreed to produce the viable and the fertile offspring.

Therefore, reproductive isolation prevents interbreeding between members of different species. It includes a collection of behavioral, evolutionary, and physiological processes.

Learn more about reproductive isolation on:

https://brainly.com/question/3089401

#SPJ3

Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?​

Answers

Its oxygen because all living organisms need oxygen to survive

A new drug is discovered for the treatment of thyroid cancer. Which is a logical next step of the scientific method after the discovery has been successfully tested?


keeping the information private

testing the drug on animals

sharing the data with other scientists

testing the drug on people

Answers

Answer:

The answer would probably be either c or d

The conditions for an enzyme to work need to be?

Answers

They need to be capable of making proteins in that area

In a chemical bond between two or more atoms, what creates the bond?
A. Proton pairs
B. Electron pairs
C. Diametric energy force
D. The nucleus

Answers

Answer:

I think C diameteic energy may be right ans\

why does the cell get longer during anaphase

Answers

Answer:chromosomes are separated by a structure called the mitotic spindle and then pulled by the spindle to opposite poles of the cell

Explanation:

Fossils usually occur in metamorphic rock. true or false?​

Answers

Answer:

false

Explanation:

They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!

Answer:

false

Explanation:

Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks

Which action is harmful to organisms living in water ecosystems

Answers

general pollution! as well as cultural eutrophication! could be harmful to water ecosystems and are in fact the most prominent reason. pollution could include excess fertilizer run off going into a creek. the nitrogen and phosphorus will create a perfect environment for algae and bacteria. thus leading to cultural eutrophication.

Is glucose more or less complex than the rest of the biomolecules? Explain.

Answers

Answer:

Less complex.

Explanation:

Glucose is both a monomer and simple sugar.

Glucose is a monosaccharide. It is a biomolecule. It is less complex than the rest of the biomolecules, such as proteins, lipids, and other complex carbohydrates like glycogen.

 

What is a biomolecule?

Biomolecules are present inside the cell. Carbohydrates, proteins, and lipids are some examples of biomolecules. Carbohydrates are divided into monosaccharides, disaccharides, and polysaccharides.

A monosaccharide has a single unit. Examples are glucose, fructose, etc. A disaccharide consists of two units. An example is maltose. Maltose is made up of two units of glucose connected by a glycosidic bond. An example of a polysaccharide is glycogen. Multiple sugar units are connected by glycosidic bonds to form glycogen. It is a storage product.

Carbohydrates are present on our cell surface as peptidoglycan. Protein is a biomolecule that is made up of amino acid monomers. They make the different structures of a cell, such as actin fibers, etc. Lipid is made up of hydrogen and carbon. Examples are cholesterol, phospholipids, etc.

Hence, in comparison to all other biomolecules, glucose is the simplest.

To learn more about biomolecule, refer to the following link:

https://brainly.com/question/12299485

#SPJ2

Which is not a characteristic of a Prokaryote?
A) Simple
B) Has a nucleus
C) Replicates via cloning
D) Always single cell

Answers

Answer:A

Explanation:

PLEASE HELP
Which process does this picture show?*

Transcription
Translation
Replication
Transformation

Answers

transformation i think iono lol

helppp hah im stuck with this

Answers

It won’t show the picture

Answer:

oh

Explanation:


What cellular structure begins to reform during telophase?

Answers

Answer:

nuclear membrane

Explanation:

The least amount of vertical change during the monthly tidal cycle occurs
a. At the beginning of the month
b. At the end of the month
c. at the quarter moons
d. at the full moon​

Answers

It’s d because if you think about it the monthly tidal cycle is a full moon and you will see that on a full moon does that make sense? Lol

What is the probability of getting a short pea plant when crossing the parents Tt with tt?

Answers

Answer:

50%

Explanation:

One half of the punnet square would be Tt and the other half would be tt.

how does the nitrogen cycle start from nitrites and end with nitrates? (full answer) ​

Answers

Explanation:

The nitrogen cycle seems to be the nitrogen form of recycling, that requires fixing of nitrogen, Teodoro mamoncillo, nitrogen removal, and deionization. The mechanism whereby the nitrogen and nitrites are subsequently converted to nitrogen fixation is denitrification. 

Other Questions
Climate change has been linked to a decrease in *A: temperature of EarthB: the rate of carbon dioxide productionC: the rate of species extinctionD: the size of the polar ice caps Which best describes the relationship between digestion and cellular respiration? O A. Digestion breaks foods down to simple sugar molecules, and respiration uses the sugar molecules to produce energy. O B. Digestion creates nutrients from food particles, and respiration uses the nutrients to produce energy. O C. Digestion releases oxygen molecules from food, and respiration uses oxygen molecules to produce energy. D. Digestion produces waste materials, and respiration uses the waste materials to produce energy. The Chinese inventedA.hunting B.FishingC.The compassD.all of the above Write STILL in the correct place in each sentence. QUESTION 4 of 10: An entertainment venue has a total advertising budget of $5 million per year. 30% of the budget is spent on social mediaand 25% is spent on traditional media. Within the traditional media spending, 15% is spent on print advertising, 50% is spent on TV advertisingand 35% is spent on radio advertising. How much is spent on radio advertising?a) $437,500b) $525,000c) $687,500d) $1,500,000 The _____ settled in the southeastern part of Texas and maintained good relations with Anglo Americans. aAlabama and Coushatta bCaddo cComanche dKiowa Which ordered pair follows the pattern in the graph?(2, 4)(3, 4)(6, 8)(6, 9) Byron earned some money mowing the neighbor's lawn. He spent one-fourth of his money to see a movie. Then he spent $6.00 on popcorn and drinks. When he went home, he had $24.00 left. How much did Byron earn mowing the neighbor's lawn? Byron earned $ .00 mowing the neighbor's lawn. Draw and use algebra tiles to solve the equation.2x - 3 = 5 Please I need help!!!From "The Tyranny of Things" by Elizabeth MorrisOnce upon a time, when I was very tired, I chanced to go away to a little house by the sea. "It is empty," they said, "but you can easily furnish it." Empty! Yes, thank Heaven! Furnish it? Heaven forbid! Its floors were bare, its walls were bare, its tables there were only two in the house were bare. There was nothing in the closets but books; nothing in the bureau drawers but the smell of clean, fresh wood; nothing in the kitchen but an oil stove, and a few a very few dishes; nothing in the attic but rafters and sunshine, and a view of the sea. After I had been there an hour there descended upon me a great peace, a sense of freedom, of in finite leisure. In the twilight I sat before the flickering embers of the open fire, and looked out through the open door to the sea, and asked myself, "Why?" Then the answer came: I was emancipated from things. There was nothing in the house to demand care, to claim attention, to cumber my consciousness with its insistent, unchanging companionship. There was nothing but a shelter, and outside, the fields and marshes, the shore and the sea. These did not have to be taken down and put up and arranged and dusted and cared for. They were not things at all, they were powers, presences.And so I rested. While the spell was still unbroken, I came away. For broken it would have been, I know, had I not fled first. Even in this refuge the enemy would have pursued me, found me out, encompassed me.If we could but free ourselves once for all, how simple life might become! One of my friends, who, with six young children and only one servant, keeps a spotless house and a soul serene, told me once how she did it. "My dear, once a month I give away every single thing in the house that we do not imperatively need. It sounds wasteful, but I dont believe it really is. Sometimes Jeremiah mourns over missing old clothes, or back numbers of the magazines, but I tell him if he doesnt want to be mated to a gibbering maniac he will let me do as I like."The old monks knew all this very well. One wonders sometimes how they got their power; but go up to Fiesole, and sit a while in one of those little, bare, white-walled cells, and you will begin to understand. If there were any spiritual force in one, it would have to come out there.I have not their courage, and I win no such freedom. I allow myself to be overwhelmed by the invading host of things, making fitful resistance, but without any real steadiness of purpose. Yet never do I wholly give up the struggle, and in my heart, I cherish an ideal, remotely typified by that empty little house beside the sea.Which of the following words from the excerpt identify what Morris values more than things?Choose one answer from each group. Type the LETTER ONLY for each answer in the correct blank.Type B, C, or D for Blank 1.B. ResistanceC. MagazinesD. FreedomType E, F, or G for Blank 2.E. PeaceF. AttentionG. DemandType H, I, or J for Blank 3.H. StruggleI. EmbersJ. Leisure 0.10( y-7)+0.02y=0.20y-0.4 it has to be an integer or decimal ergent! Silver metal can be prepared by reducing its nitrate, AgNO3 with copper according to the following equation:Cu(s) + 2 AgNO3(aq) Cu(NO3)2(aq) + 2 Ag(s)What is the percent yield of the reaction if 71.5 grams of Ag was obtained from 127.0 grams of AgNO3 ? I NEED THIS ASAP RIGHT NOWW!!! WILL GIVE BRAINLIST IF CORRECTAre amphibians more closely related to primates or ray-finned fishes? HOW do you know? List three types of government in the Middle East Which is the graph of y= 1/2x See picturePLEASE ONLY COMMENT IF YOU ARE SURE OF THE ANSWER!!! For every 2 bricks, 5 paving stones were used to build a backyard patio. James used a total of 120 bricks to complete his patio. Of the paving stones he used, 46% were tan in color while the rest were gray.How many gray paving stones were used to build the patio? Frank thinks that 2x + 3x2 is the same as 5x3. Which statement shows that it is NOT the same? 2x + 3x2 = 5x2 2(6) 3(6)2 5(6)3 2x + 3x 5x 2(4) + 3(4)2 5(4)3 what is the function, domain, and range??{(1,-2), (-2,0), (-1,2), (1,3)} Compare and contrast the 3 triangle congruency ASA, AAS and SAS. 1 What is the purpose of using direct quotes in a summary?To prove that you read the book or articleTo give your reader something else to think aboutTo make summary a little longer than it would be otherwiseTo make the summary more interesting to read