A student attaches a block to a force sensor and pulls it across a frictionless table. The sensor measures the block's acceleration What type of mass does the student measure ?
a. gravitational mass
b. inertial mass
c. neither

Answers

Answer 1

Answer:Inertial mass

Explanation:When we measure gravitational mass we find the strength of an object's interaction with a gravitational field.

When we measure inertial mass we find an object's resistance to being accelerated by a force.

An object's gravitational mass and inertial mass are the same.

We apply a force and measure the resulting acceleration, so we can use Newton’s second law to find the inertial mass.


Related Questions

A ball of radius R and mass m is magically put inside a thin shell of the same mass and radius 2R. The system is at rest on a horizontal frictionless surface initially. When the ball is, again magically, released inside the shell, it sloshes around in the shell and eventually stops at the bottom of the shell. How far does the shell move from its initial contact point with the surface

Answers

Answer:

[tex]x =\frac{-R}{2}[/tex]

Explanation:

From the question we are told that mass

Thin layer radius [tex]= 2R[/tex]

Generally the expression for ths solution is given as

Xcm =(m*0 =m(-2R))/2m =-mR/(2m)=-R/2

the center of mass will not move at initial state  

Considering the center of mass of both bodies

[tex]xcm=\frac{m*x+m*x)}{2m} =x[/tex]

[tex]x =\frac{-R}{2}[/tex]

Therefore the enclosing layer moves [tex]x =\frac{-R}{2}[/tex]                          

The shell move from its initial contact point with the surface is,

[tex]x =\dfrac{-R}{2}[/tex]

Given-

Radius of the ball is [tex]R[/tex].

the mass of the ball is [tex]m[/tex].

The mass of the thin shell is [tex]m[/tex].

The radius of the thin shell is [tex]2 R[/tex].

For the two bodies with mass [tex]m[/tex], the center of mass can be given as,

[tex]x_{cm}=\dfrac{m_{1} x_{1}+m_{2} x_{2} }{m_{1} +m_{2}}[/tex]

In the given question, the mass of both the bodies are equal and the given distance of center of mass for both bodies are also equal. Therefore,

[tex]x_{cm}=\dfrac{m x_+mx }{m +m}[/tex]

[tex]x_{cm}=\dfrac{2mx }{2m}[/tex]

[tex]x_{cm} =x[/tex]

Distance for center of mass can also be given as,

[tex]x_{cm} =m\times o[/tex]

[tex]x_{cm} =m\times \dfrac{-R}{2m}[/tex]

[tex]x_{cm} =\dfrac{-R}{2}[/tex]

Comparing both the values of the distance of center of mass we get,

[tex]x =\dfrac{-R}{2}[/tex]

Hence, The shell move from its initial contact point with the surface is,

[tex]x =\dfrac{-R}{2}[/tex]

For more about the center of mass follow the link below,

https://brainly.com/question/8662931

A golf ball is sitting on a tee. The ball is struck with a golf club and flies
through the air. How does the force on the club compare with the force on the
ball when momentum is transferred between the club and ball?

Answers

Answer:

c i kn now it is

Explanation:

A car with a mass of 900 kg is traveling at a
speed of 25 m/s. What is the kinetic energy
from the car's motion?

Answers

Explanation:

Kinetic Energy

= 0.5mv²

= 0.5(900kg)(25m/s)²

= 281,250J.

Which screw would create a strong hold?

Answers

Structural screws are a relatively new fastener option that's been getting a lot of good reviews, and for good reason. Though they're much thinner than lag bolts, they're made of hardened steel and are extremely sharp. That makes them easier to drive with a drill—no pilot holes needed.

Determine the energy lost, due to friction, as an 8000 N car that skids to a stop, if its initial velocity was 12 m/s.

Answers

Answer:

58,800Joules

Explanation:

The energy lost is equal to the workdone by the car as it skids.

Workdone = Force * Distance

Given

Force = 8000N

Get the distance using the equation of motion

v² = u² - 2gS

0² = 12² - 2(9.8)S

-12² =  - 2(9.8)S

-144 = -19.6S

S = 144/19.6

S = 7.35m

Calculate the required energy

Workdone = 8000 * 7.35

Workdone = 58,800Joules

Hence the energy lost due to friction is 58,800Joules

help plz The sum of all chemical reactions that take place within an organism is known as ______________. *

Answers

Answer:

Metabolism

Explanation:

metabolism is the sum of all chemical reactions that take place within an organism

Answer:

Metabolism

Explanation:

15. Use the chemical equation below to determine how many moles of ammonia
(NH) will be produced from 4 moles of nitrogen gas (N). Assume that there is enough H, for all of the N, to be converted to NH.
N2 + 3H2 + 2NH
8 moles
2 moles
3 moles
4 moles

Answers

Answer:

I'm not really sure but I think it is

four

28. A student notices that when a weight is hung on a spring, the spring stretches. She decides to conduct an experiment to determine the relationship between the amount of weight
placed on a spring and the distance the spring stretches. She has five different weights: 25 9,50 9.75 9. 100 9, and 125 g. She selects a weight, hangs it on the spring, and
measures how far the spring stretches
What is the independent variable in this experiment?
length of unst etched spring
distance the spring stretches
weight hung from the spring
O temperature of the spring

Answers

Answer:

C). weight hung from the spring

Explanation:

An Independent variable is characterized as the variable that is controlled or manipulated by the experimenter in order to observe its change on the dependent variable.

In the given experiment, 'weight hung from the spring' is the independent variable as it is manipulated by the researcher in order to witness its impact on the dependent variable(how the spring stretches). It is the cause that causes an effect on the dependent variable. Any change in the former directly affects the latter. Thus, option C is the correct answer.

NEED AWNSER NOW! WILL MARK BRAINLY! Which term is defined as the ratio of the speed of light in a vacuum to the speed of light in the material it is passing through?

index of reflection

index of refraction

angle of reflection

angle of incidence

Answers

Answer:

Index of refraction.

Answer:

index of refraction

Explanation:

I just took the k12 quiz.

In May 1990 the French TGV train traveled the distance from Paris to Lille, France (127 miles) in 0.819 hours. What was the speed of the TGV in m/s

Answers

Answer:

v=69.32 m/s

Explanation:

you have to transfer the distance from mile to meters (from miles to meters multiply by 1609)

so d=204387 m

you have to transfer the time from hour to second (from hour to second multiply by 3600)

so t=2948.4 s

the rule says v=d/t=204387/2948.4= 69.32 m/s

The TGV train has a speed of 69.306 meters per second.

Let suppose that TGV train is travelling at uniform velocity, then we can be calculated its speed by means of the following kinematic equation:

[tex]v = \frac{x}{t}[/tex] (1)

Where:

[tex]v[/tex] - Speed, in meters per second.[tex]x[/tex] - Distance travelled by the train, in meters.[tex]t[/tex] - Time, in seconds.

Now we proceed to convert both distance and time in terms of fundamental units:

Distance:

[tex]x = 127\,mi \times 1609\,\frac{m}{mi}[/tex]

[tex]x = 204343\,m[/tex]

Time:

[tex]t = 0.819\,h \times 3600\,\frac{s}{h}[/tex]

[tex]t = 2948.4\,s[/tex]

If we know that [tex]x = 204343\,m[/tex] and [tex]t = 2948.4\,s[/tex], then the speed of the TGV train is:

[tex]v = \frac{204343\,m}{2948.4\,s}[/tex]

[tex]v = 69.306\,\frac{m}{s}[/tex]

The TGV train has a speed of 69.306 meters per second.

We kindly invite you to check this question about kinematics: https://brainly.com/question/24468164

Which is heavier: 30 kilogram or 300 milligrams?

Answers

Answer:

30 killograms is 85.9803

and 300 milligrams is 0.000661387 pounds

Explanation:

The Sears Tower in Chicago is approximately 444 m tall Suppose a book
dropped from the top of the building what would be the book's velocity
point 222 m above the ground Neglectair resistance.
O 66.0 m/s (downwards)
2.00 m/s upwards)
22.0 m/s (downwands)
/s (
) 66.0 m/
swards,​

Answers

Answer:

A. 66.0 m/s downwards

Explanation:

The Tower has a height of 444m

The book is dropped ,finding the velocity of the book 222m above the ground, means the book will be on air for a  height of 222 m .

Apply the formula for free fall in a horizontal projection as;

h= u²×sin²∅ /2g  where

h= maximum height =222m

g= acceleration due to gravity =9.81 m/s²

∅ = projectile angle = 0

u = velocity of the book

Applying the formula as ;

h= u²×sin²∅ /2g

222 = u²/2*9.81

222*19.62 = u²

4355.64 = u²

√4355.64 = u

65.99 m/s = u

66 m/s  downwards

WRITE A PARAGRAPH ABOUT PRESSURE

Answers

Answer:

pressure is a horrible thing to go through, it can lead to many bad side effects, like burn out and it can also lead to high blood pressure, head aches, heart problems, depression, anxiety, and many more damaging effects. Pressure can destroy someones mental health if not dealed worth properly

I hope this is okay! I'm not sure what pressure you meant

Which type of pressure are you referring to ?

If you could change one property of a substance ( solid, liquid, and gas) you have to use in your daily life, what would it be and why?
Please hurry
I will give you BRAINLIEST!!!!!!
And pleaseee write 5 sentences why??

Answers

Answer

Soap into a liquid

Explanation:

water into ice cubes, because lukewarm water is nasty.


Need help can someone tell what each circuit is

Answers

Answer:

In geometry, parallel lines are lines in a plane which do not meet; that is, two straight lines in a plane that do not intersect at any point are said to be parallel. Colloquially, curves that do not touch each other or intersect and keep a fixed minimum distance are said to be parallel.

In a series circuit, the current that flows through each of the components is the same, and the voltage across the circuit is the sum of the individual voltage drops across each component. ... In a series circuit, every device must function for the circuit to be complete.

In a series circuit, all components are connected end-to-end, forming a single path for current flow. In a parallel circuit, all components are connected across each other, forming exactly two sets of electrically common points.

Explanation:

I hope these helps^,^      ^_^

An object has a force of 29.43 N acting on it. Its acceleration is 3.5 m/s2. What is the mass of this object?

Answers

Answer:

The mass of the object is 8.41 Kg.

Explanation:

Mechanical Force

The second Newton's law states that the net force exerted by an external agent on an object of mass m is:

F = m.a

Where a is the acceleration of the object. The SI unit for the force is the Newton: [tex]1\ Nw = 1~Kg.m/s^2[/tex]

We are given the net force of F=29.43 N acting on an object and producing an acceleration of a=3.5~m/s^2.

To calculate the mass of the object, we solve the above equation for m:

[tex]\displaystyle m=\frac{F}{a}[/tex]

[tex]\displaystyle m=\frac{29.43}{3.5}[/tex]

Calculating:

m = 8.41 Kg

The mass of the object is 8.41 Kg.

Two soccer players run toward each other. One player has a mass of 85 kg
and runs west with a speed of 8 m/s, while the other has a mass of 105 kg
and runs east with a speed of 7 m/s. What is the total momentum of the
system made up of the two players?

Answers

Answer:

Total momentum, p = 55 kg-m/s

It is given that,

Mass of player 1, m₁ = 85 kg

Mass of player 2, m₂ = 105 kg

Speed of player 1, v₁ = -8 m/s (west)

Speed of player 2, v₂ = 7 m/s (east)

Momentum is equal to the product of mass and velocity. For this system, momentum is given by :

p=m_1v_1+m_2v_2p=m

1

v

1

+m

2

v

2

p=85\ kg\times (-8\ m/s)+105\ kg\times 7\ m/sp=85 kg×(−8 m/s)+105 kg×7 m/s

p = 55 kg-m/s

The total momentum of the system made up of the two players is 55 kg-m/s.

Answer:

p = 55 kg * m/s east

Explanation:

The answer above explains it neatly, but leaves the direction out of the answer. The player heading east has more momentum, so the net momentum of the system is east.

The temperature of rock located 1,000 kilometers below the Earth's surface is about a. 200 C b.2,100 C c.2,800 C d.3,200 C

Answers

The temperature would be 3,200 °C!!

Brainliest, please! <3

The temperature of the rock located at 1,000 km below the earth' surface has been 3200 degree Celsius. Thus, option D is correct.

The temperature at the earth's surface has been found to be nearly 0 degree Celsius. According to the geology of the earth, the temperature has been increased to 1500 degree Celsius by digging 100 km below the earth surface.

Thus, the temperature at 100 km from earth surface has been 1500 degree Celsius.

On moving down from 100 km, there has been a rise in temperature, and at the mouth of the mantle at 1000 km, the temperature has been approximately 3500 degree Celsius.

Thus the temperature that has been near  about 3500 degree Celsius is 3200 degree Celsius. Thus, the temperature of the rock at 1000 km below the earth surface has been 3200 degree Celsius. Thus, option D is correct.

For more information about the temperature of earth, refer to the link:

https://brainly.com/question/893891

Many things can alter your heart rate including: exercise, diet, nutrition, sugar, and caffeine

True or false

Answers

Answer:

true

Explanation:

Gasoline is an example of an accelerant. True False

Answers

Answer:

true

Explanation:

Answer:

I believe its true

Explanation:

Gasoline is the most common fire accelerant used but it could also be present at a scene as an ignitable liquid due to gasoline being a common fuel. Although ignitable liquids are the most common fire accelerants it is possible to have other chemicals being used as a fire accelerant.

Why do you think it is colder during the winter than the summer?

Answers

Answer:

As the earth travels around the sun during the year it maintains this tilt. Because of this tilt, in the summer we (north of the equator) are slanted more directly towards the sun so it's hotter. In the winter, we're slanted away so the sun's rays are less direct, making it colder.

If the position of a particle on the x-axis at time t is −5t2, then the average velocity of the particle for 0 ≤ t ≤ 3 is

Answers

Answer:

v = 15 m / s

Explanation:

In this exercise we are given the position function

          x = 5 t²

and we are asked for the average velocity in an interval between t = 0 and t= 3 s, which is defined by the displacement between the time interval

          [tex]v= \frac{v_{f} - v_{o} }{t_{f} - t_{o} }[/tex]

let's look for the displacements

        t = 0     x₀ = 0 m

        t = 3     [tex]x_{f}[/tex] = 5 3 2

                     x_{f} = 45 m

 

we substitute

           [tex]v = \frac{45 -0}{3 - 0}[/tex]

           v = 15 m / s

Using Velocity vs Time Graphs to Find Acceleration
A graph titled velocity versus time has horizontal axis time (seconds) and vertical axis velocity (meters per second). A line has 4 straight segments. Line segment A runs from 0 seconds 0 meters per second to 1 seconds 15 meters per second. Then segment B runs to 2 seconds 20 meters per second. Then segment C runs to 4 seconds 20 meters per second. Then segment D runs to 5 seconds 0 meters per second.

The acceleration of segment D is m/s2.



Rank segments A, B, and C from least acceleration to greatest acceleration.

Least:








Greatest:

Answers

The acceleration at segment D is -20m/s²

The rank of the acceleration from the least to the greatest is -20m/s² < 0m/s² < 5m/s² < 10m/s² (D<C<B<A)

Acceleration is the change in velocity with respect to time.

a = v-u/t

Acceleration at segment A:

Aa = 15-0/1-0

Aa = 15m/s²

Acceleration at segment B:

Ab = 20-15/2-1

Ab = 5m/s²

Acceleration at segment C:

Aa = 0-0/4-2

Aa = 0m/s²

Acceleration at segment D:

Ac = 0-20/5-4

Ac = -20m/s²

Hence the acceleration at segment D is -20m/s²

The rank of the acceleration from the least to the greatest is -20m/s² < 0m/s² < 5m/s² < 10m/s² (D<C<B<A)

Learn more here: https://brainly.com/question/18398656

What is the mass of an object that accelerates at 5 m/s2 when pushed with 100 N?

Answers

Answer:

the answer is 20g

Explanation:

Data:

acceleration:5m/s2

force:100N

mass:?

solution:

force: mass*acceleration

mass: force divided by acceleration

mass:100/5

mass:20g

or another way of solving it is

force: mass*acceleration

100:mass*5

100/5 : mass

20g:mass

The sun's energy begins as what form of energy?

Answers

Answer:

nuclear energy.............

The sun's energy begins in the nuclear form of energy. Nuclear energy is the origin of the sun's energy.

Nuclear energy originates from the sun's energy. Nuclear fusion processes happen at the sun's core, transforming protons from hydrogen into helium and releasing a tremendous amount of energy in the process. Nuclear fusion is the term for this action.

Helium nuclei are created from the collision and fusion of hydrogen nuclei in the sun's core, which experiences extremely high temperatures and pressures. An enormous quantity of energy is released during the nuclear fusion process in the form of electromagnetic radiation, especially visible light photons and other types of electromagnetic radiation.

The intense heat and brightness of the sun are maintained by the energy generated by nuclear fusion in its core, giving it a potent source of light and heat that sustains life on Earth and powers a variety of atmospheric and climatic processes.

Hence, the sun's energy begins in the nuclear form of energy. Nuclear energy originates the sun's energy.

To learn more about energy, here:
https://brainly.com/question/1932868

#SPJ6

define light?it's types​

Answers

Answer:

Light or visible light is electromagnetic radiation within the portion of the electromagnetic spectrum that can be perceived by the human eye. Visible light is usually defined as having wavelengths in the range of 400–700 nm, or 4.00 × 10⁻⁷ to 7.00 × 10⁻⁷ m, between the infrared and the ultraviolet.

Explanation:

This is one type of light.

A 200-gram baseball traveling at 48 m/s is hit by a bat and rebounds in the opposite direction at 52 m/s. Find the average force of the bat on the ball if the time of contact is 2.0x10-3 s.

Answers

Answer:

400N

Explanation:

Given the following parameters

Mass m = 200g = 0.2kg

initial velocity u = 48m/s

Final velocity v = 52m/s

Time t = 2.0x10-3 s.

Impulse is expressed as I = Ft = m(v-u)

Ft = m(v-u)

F =  m(v-u)/t

Substitute the given values into the formula

F = 0.2(52-48)/0.002

F = 0.2(4)/0.002

F = 0.8/0.002

F = 400N

Hence the average force of the bat on the ball is 400N

In projectile mtion, what is the y-component of the initial velocity? if V= Vi = 100 m/s and the angle with horizontal axis Θ = 30 degrees

Answers

Answer:

hence the y - component of the velocity is 50m/s

Question 8 of 15
Which of the following distinguishes electromagnetic waves from mechanical
waves?
A. They carry energy.
B. They have frequencies.
C. They have wavelengths.
D. They don't require a medium to travel through.


Answers

Answer:

D. They don't require a medium to travel through.

Explanation:

Electromagnetic waves and mechanical waves are both types of waves. Electromagnetic waves are waves that arise from the combination of electric and magnetic fields while mechanical waves are waves that arise as a result of transfer of energy via matter.

One major difference between these two types of waves is that electromagnetic waves such as light waves, radiowaves etc. do not need a medium to travel i.e. they can travel through a vacuum, while on the other hand, mechanical waves such as sound waves need a medium to travel.

Answer:

They don't require a medium to travel through

Explanation: hope this helps

A train travels with a speed of 115km/hr. How much time does it take to cover a distance of 470km.​

Answers

It would take approximately 4 hours for the train to cover a distance of 470km.

4 hours 5 minutes 13.04 seconds

Other Questions
Let f(x) = 9x and g(x) = x + 7. What'sthe smallest number that is in the domain offg?Enter the correct answer.OOOODONEClear all what was the strength and weakness of Adam Smith and David recardo A man travels 320 miles in 8 hours. If he continues at the same rate, how many miles will hetravel in the next 2 hours? what is the largest prime number? what should be added2x ^3+ 3x^2+8x-4to get 0 ? pls help asap! This homework is really hard what is the meaning of zest Which outcome was a benefit of the Pax Romana?The citizens of Rome were allowed to participate in government.AThe Roman Empire entered a period of economic prosperity.BThe citizens of Rome were encouraged to move up in classThe Roman Empire encouraged religious freedom.D Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry...