AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer 1

Answer:

what?

Explanation:


Related Questions

PLEASE HELP AM HAVING A MENTAL Breakdown!!!


What enzyme opens up in the DNA into two single strands ?

Answers

Answer:

DNA helicase

Explanation:

The image of this question shows the replication of DNA into two identical copies. However, before this occurs, the double-stranded DNA needs to be unwound or separated so that each single strand can serve as a template for a new strand.

An enzyme called DNA helicase is responsible for the separation of the DNA molecule into single strands. After which, DNA polymerase begins to add nucleotides to each single strand of DNA.

Everybody meu-nbht-zzn

Answers

ok

we are talking gibberish now

so...

neu cbnsj habbe

R u doing sex on this code huh?...........
If yes then please stop this!

all the different organisms interacting in a pond make up..?

Answers

Answer:

Population

hope this helps

have a good day :)

Explanation:

Explain the causes of the seasons

Answers

Answer:

weather

Explanation:

Earth has seasons because of its axis is tilted.Earths axis is always pointed in the same direction so different parts of Earth get the suns direct rays throughout the year.For example in summer the sun rays hit that region more directly than at any other time of the year. Have a good day

Después de la fecundación, la célula recién formada llamada cigoto lleva a cabo divisiones sucesivas hasta desarrollar un nuevo individuo. Estas divisiones se llevan a cabo mediante el proceso llamado

Answers

Answer:

Después de la fecundación, la célula recién formada llamada cigoto lleva a cabo divisiones sucesivas hasta desarrollar un nuevo individuo. Estas divisiones se llevan a cabo mediante el proceso llamado segmentación.

Explanation:

Luego de que se produce la fecundación del óvulo y se forma el cigoto, los 3 a 4 días que le siguen abarca un proceso llamado segmentación. En este proceso se producen sucesivas divisiones celulares dando blastómeros, los cuales son células que forman el embrión y a las estructuras que este necesita para desarrollarse. La segmentación es un proceso que ocurre en las trompas de falopio mientras el cigoto se desplaza hacia el útero donde se implantará.

why does DNA never leave the nucleus

Answers

Answer:

DNA cannot leave the nucleus because that would risk it getting damaged.

what is an adaptation

Answers

Answer:

a change or the process of change by which an organism or species becomes better suited to its environment

Explanation:

Answer:

ad·ap·ta·tion

/ˌadapˈtāSH(ə)n/

Learn to pronounce

noun

the action or process of adapting or being adapted.

"the adaptation of teaching strategy to meet students' needs

"filming her adaptation of a beloved children's book

Explanation:

Just search it up

Lily Color Genetics
Genotype
Phenotype
YYPP
orange
pink
ҮyPP
Orange lilies get their color from two genes, a
gene for yellow pigment and a gene for pink
pigment. Each gene has a dominant allele and a
recessive allele: Y and y for the yellow gene, P
and p for the pink gene.
pink
yyPP
• When both pigments are expressed, the
flowers appear orange.
• When only one pigment is expressed, the
flowers are either yellow or pink.
• When neither pigment is expressed, the
flowers appear white.
ҮҮРp
YyPp
yypp
YYpp
Yypp
yypp
Fill in the correct phenotype (color) for each
genotype in the table.
Show Answer
2 of

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the concept of Genetics and color.

According to the above condition, we will get the remaining results of crisscross as,

4.) YYPp ==> Yellow

5.) YyPp ==> Orange (both expressed)

6.) yyPp ==> Pink

7.) YYpp ==> Yellow

8.) Yypp ==> Yellow

9.) yypp ==> White

In this case, we have to recognize the concepts of genetics, so the phenotype for each exercise color:

YYPP=orangeYyPP=orangeyyPP=pinkYYPp=orangeYyPp=orangeyyPp=pinkYYpp=yellowYypp=yellowyypp=white

What is a phenotype?

Phenotype is an important concept adopted in Genetics and is usually defined as the set of observable characteristics of an organism. In this sense, the morphological and physiological characteristics of an individual are included in this set.

So from the information given in the statement we have that:

When both pigments are expressed, the flowers appear orange.When only one pigment is expressed, the flowers are either yellow or pink.When neither pigment is expressed, the flowers appear white.

Phenotypes are expressed by the following colors:

YYPP=orangeYyPP=orangeyyPP=pinkYYPp=orangeYyPp=orangeyyPp=pinkYYpp=yellowYypp=yellowyypp=white

See more about phenotype at brainly.com/question/20730322

Describe Charles Darwin's theory of natural selection

Answers

Answer:

it sghwbdhfbwahdfk

Explanation:

Answer:

Explanation:

Darwin's Theory of Evolution by Natural Selection

More individuals are produced each generation that can survive. Phenotypic variation exists among individuals and the variation is heritable. Those individuals with heritable traits better suited to the environment will survive.Charles Darwin's theory of evolution states that evolution happens by natural selection. Individuals in a species show variation in physical characteristics. ... As a consequence those individuals most suited to their environment survive and, given enough time, the species will gradually evolve.

8. The graph below shows the reaction rates of two different reactions. Which of the following statements could explain the difference in the two reactions? ​

Answers

Answer:

These two reactions have different reactants, bonding and catalysts.

Explanation:

The two reactions are different from one another due to fusion of different reactants as well as different products. These two reactions may have different types bonding i.e. covalent, ionic or metallic bond etc between their atoms. In these two reactions, different types of catalyst are used which helps in speedup the chemical reaction so we can conclude that these two reactions have different reactants, bonding and catalysts in their chemical reaction.

-What is DNA replication?
-Where does it happen?
-Why does it happen, to prepare for what?
-What model explains how DNA replication works?
-Use a picture to show and explain semi conservative
-What is Chargoff's rule? How is it different in RNA?
-What are mutations?
-What is the difference between point and frameshift mutations?

Answers

I hope this helps answer your question.

What role do organisms, such as bacteria or fungi, that feed on and break down dead plant or animal
matter and make nutrients available play in an ecosystem?
producers
predators
decomposers
consumers
NO LINKS

Answers

decomposers, because they break down (decompose) the dead matter and put the nutrients back into the soil.

What strategies should be considered for an HIV vaccine?

Answers

A deeper study into the virus itself

Significado del acoplamiento entre CTE y FosOx, es de bioquimica si alguien me puede ayudar por favor

Answers

Answer:

La teoría quimiosmótica indica que la cadena de transporte de electrones (CTE) y el proceso de fosforilación oxidativa (FosOx) están acoplados por un gradiente de protones.

Explanation:

La teoría del acoplamiento quimiosmótico propuesta por Peter Dennis Mitchell permite entender cómo el ADP se fosforila a ATP en mitocondrias y cloroplastos. La energía que se libera durante la cadena del transporte de electrones es utilizada por la célula para crear un gradiente de protones a través de las membranas internas de mitocondrias y cloroplastos. Subsecuentemente, la energía potencial creada a partir de este proceso es liberada por el movimiento de protones a favor de un gradiente electroquímico. Finalmente, la energía potencial creada a partir del flujo de electrones es acoplada a la fosforilación oxidativa para sintetizar enlaces fosfato de alta energía en el ATP a partir de ADP y fosfato (Pi).

What would you eat for the rest of your life and why

Answers

Answer:

I would eat organic food or natural food

Explanation:

Because these type of food does not contain chemicals or are not artificial or are not even genetically modified which can be not good for our health but the organic foods are the best for our health.

at what point did the climate began to fluctuate more severely ? (2 points )

Answers

Answer:

Due to greenhouse gases.

Explanation:

When the high emission of greenhouse gases occurs, the climate began to fluctuate more severely because greenhouse gases such as carbondioxide gas and methane etc block the solar radiation that is reflected back to space which is responsible for the change of climate. If there is more greenhouse gases are emitted in the atmosphere so there is more fluctuation in the climatic condition of earth atmosphere so we can conclude that greenhouse gases leads to fluctuation of climatic conditions more severely..

Explain which sound wave has the greatest amplitude?

A
Wave A because the compressions and rarefactions are more similar, so it has a larger amplitude.
B
Wave A because the rarefactions are more tightly packed, giving it a greater frequency
C
Wave B because the tightly packed compressions give it a longer wavelength.

D
Wave B because the compressions are more tightly packed, giving it a larger amplitude

Answers

D

Wave B because the compressions are more tightly packed, giving it a larger amplitude

D I hope this helps a lot have a good day bye

A company called Sierra Pacific Industries is destroying forests by a destructive and non-sustainable practice called clearcutting. This is being done at an alarming rate in specific counties in California.

A.Primary Succession
B.Secondary Succession​

Answers

Answer:

Secondary succession.

Explanation:

Clearcutting leaves an area barren. It is a  horrible practice and is opposed by every environmental group. There are better ways of logging without destroying the plant life present there.  This is secondary succession because plant life did exist in the area that clear cut and will again if the logging company or the government will replant the area.

Which of the following is something that all living organisms have in common ?
A.) They all contain at least one cell .
B.)They all need a source of oxygen .
C.) They all use other organisms for food .
D.)They all find mates to reproduce .

Answers

Explanation:

B is absolutely correct answer.

Explain the water cycle step by step in your own words

Answers

Answer:

The Water Cycle Step 1. The sun happens to be the driving force of the water cycle. It heats up the water in seas, rivers, lakes and... Step 2. This water vapor then comes in contact with air currents, which take it higher into the atmosphere. After... Step 3. These clouds move all round the globe ...

Explanation:

D
Question 8
2 pts
The symbiotic relationship that occurs when a bee benefits from the nectar of a plant
and other plants are pollinated by the bee carrying the nectar is called
Select)
This type of relationship occurs when
[ Select]

Answers

Answer:

Mutualism, this happens when both organisms benefit. Good luck on whatever your doing mate, have a great day.

Explanation:

Question 14 (2 points)
A series of organisms listed in a way that shows which is a food source for another is
called a(n)
A
while an)
Ą
is made up of multiple connected energy paths in an ecosystem.

Answers

Answer:

a

Explanation:

the answer is a ecosystem

A Series of organisms listed in a way that shows which .....

describe the process of cell division that occurs to produce daughter cells during asexual reproduction

Answers

Answer:

The primary mechanism by which organisms generate new cells is through cell division. During this process, a single "parent" cell will divide and produce identical "daughter" cells. In this way, the parent cell passes on its genetic material to each of its daughter cells. ( Hope it helps )

which of the following is NOT a natural resource?

A gold

B water

C oil

D fire

Answers

Answer:

D

Explanation:

Fire is man made because for there to be fire you have to strike a match or use other man made sources

what happened to the oil when you first dumped it into the water? explai the effects of oil spills on the ocean ecosystem

Answers

Since most oils are less dense than water it will float and eventually spread out and cause harm to almost all marine animals oil also destroys insulating ability on marine animals with fur like sea otters

Explique en que consiste el funcionamiento del SNC y SNP en el acto reflejo mencionando a lo menos 2 características del proceso

Answers

Answer:

SNP → Envía la información de los estimulos al SNC (neuronas aferentes) y lleva una respuesta hacia los efectores (neuronas eferentes).

SNC → Recibe la informacion que envia el SNP, la procesa y envía una respuesta hacia el organo efector (interneuronas).

Explanation:

Al hablar del arco reflejo se hace referencia a la secuencia de pasos que se llevan a cabo para que el cuerpo reaccione ante un estímulo externo.  

En términos gerenales, el sistema nervioso periférico recibe informacion a modo de estimulo del medio externo. Esta información es enviada al sistema nervioso central, donde se procesa y se envía una respuesta adecuada en función del estimulo. Este mecanismo es el arco reflejo.

Existen tres tipos de neuronas involucradas en el arco reflejo.  

Neuronas aferentes o sensoriales Interneuronas Neuronas eferentes o motoras

Modo de acción:  

Rama ascendente

El estímulo llega al cuerpo y es recibido por receptores sensoriales especializados que responden a ellos. La información recibida por estos receptores, es convertida de energia del estímulo (temperatura, luz, presión, etc) a energia del potencial de acción.  

Las neuronas aferentes, ubicadas en la dermis y epidermis, reciben la información de los receptores, reaccionan al estímulo y envian esa información al sistema nervioso central a modo de impulsos nerviosos.

Rama descendente

Una vez que la información llega al sistema nervioso central, es procesada por las interneuronas, quienes cumplen la función de análisis y procesamiento de toda la información para enviar una respuesta. Las interneuronas manejan muchas de las señales sensoriales, las evaluan, las comparan, y envian una respuesta motora.

Las neuronas eferentes reciben esta respuesta de las interneuronas, y son estimuladas para llevar estas nuevas señales desde el sistema nervioso central hacia las células de los organos efectores. El órgano efector en general puede ser un músculo o una glándula.

Finalmente, el tejido de destino responde al estimulo a modo de contracción, en caso de tratarse de un músculo, o de liberación hormonal, en caso de tratarse de una glándula.

9. Introducing an exotic species to an environment can
a improve soil fertility.
b. cause biological magnification.
c. cause native species to die out.
d increase crop yields.

Answers

Answer:

The answer would be: C. Cause native species to die out.

Explanation:

The Everglades is a prime example of this. The python is a non-native, exotic species. It has caused over 99% of native species to die out.

Let me know if I am correct! :>

What do these layers and their fossils suggest about Earth's history?

Answers

Answer:

D. there has been changes in Earths lifeforms over time.

Explanation:

What do carbohydrates provide to humans?
A. less mass

B. Light

C. Quick Energy

Answers

Answer:

It's definitely not light...so the most practical answer is c. quick energy.

Do you think fords suck why or why not

Answers

Answer:

yes i do

Explanation:

i personally think gmc and chevy are the best truck made, but thats just my opinion.

Other Questions
jueves: _Complete the sentences with the correct form of the verb tener with correct tener idiom. 1. Carlota ________ estudiar porque presenta una examen hoy. 2. Marina y yo ______ porque no comemos comida por la maana. 3. Yo _________ el autobus llega tarde. 4. Yo ________ jugar al ftbol porque me gustan los deportes. 5. Felipe y Nicols _________ porque corren mucho Help Please!!!!!!!!!!!!!!!! Thank you very much if you can help!1. What was the Spanish Inquisition? How did Spain try to spread Catholicism in Europe? How did Spain spread Catholicism on other continents?2. How did the Greeks contribute to the Scientific Revolution? How did the Jewish people contribute? How did the Muslim people contribute? How did the Renaissance scholars contribute?3. What are the 2 specific ways the Catholic Church tried to stop the spread of the Protestant religion?4. What was the Peace of Augsburg? What was the Edict of Nantes? What was the Peace of Westphalia? DId these 3 events reduce the power of the Pope or increase his power?Again thank you so much if you can help me. Part 1: How many phone numbers can be made if all the digits (that is, 10 digits) needto be filled in and any single digit number (0-9) can be used for any digit?Part 2: How many phone numbers can be made if the first digit must be 1, the second digit must be a number in the range 3-5, the third digit must be a number in the range(6-9), and the last seven digits can be any single digit number 0-9?PLZ HELP ASAP WOULD GREATLY APPRECIATE IF U R HERE TO NOT HELP DON'T BOTHER OR DON'T PUT A LINK THAT LEADS TO NOTHING THANK YOU! What does a touch ring allow an artist to do on an a digital tablet Best answers will be marked Brainliest I need help!You're in a town called Watertown. You need to save it from water pollution. They don't have any money! SO, they need you to use stuff from your house (imagine). Make a design that shows how to stop it from happening. How could you clean the water in your model using the materials around the house? PLEASE HELP ME! I NEED HELP!! IF YOU GOT ONE, MAKE A QUESTION AND ILL GIVE YOU ALL MY POINTS. what is the first president of United state Which organism would make a good bioindicator?O A. an organism that is endangeredB. an organism that is tolerant of slight physical or chemical changeso C. an organism that has reached its carrying capacity in the ecosystemo D. an organism that is sensitive to slight physical or chemical changes Can someone Help please Compare comets, meteors and steroids Write a short answer for the question How did volcanic activity and meteor impacts affect the atmosphere and life on Earth? banana with an average mass of 0.15 kg and average specific heat of 3.35 kJ/kg C is cooled from 20C to 5C. The amount of heat transferred from the banana isa.62.1 kJb.7.5 kJc.None of thesed.6.5 kJe.0.85 kJf.17.7 kJ I have some true or false questions I need help with. 9th grade.** Handware can be tracked back to ancient times. Over six centuries ago.True or false.Hardware is only found in computers.True or false. I knowInstruments and weaving looms where some of the first pieces of hardware.True or false.Computers and hardware is the same thing True or false. Oral contraceptives often contain synthetic estrogens and progesterone for 21 days, and then placebo pills that do not have hormones for days 22-28. Why would this prevent pregnancy? Do such pills prevent ovulation? Do they prevent menstruation? Explain. Water at 110*C is aA. gasB. liquidC. solidD. plasma Help please asap will mark brainliest! DTo find Tecumseh and bring him to Washington D.C.3. Using Source 1, what geographic advantage did the U.S. gain with the purchase of the Louisiana Territory?A. More ports along the Atlantic coast that allowed for faster transportation to and from EuropeB. Full control of the Mississippi River for quicker tradec. Access for the first time to the Great Lakes that allowed for an increase in the fishing industryD. Access to the Pacific Ocean for trade with the East A bicyclist needs to pass two check points before completing a race. The matrix equation that represents the distance, in miles, from the starting point to checkpoint 1, y represents the distance from checkpoint 1 to checkpoint 2, and z represents the distance from checkpoint 2 to the finish line. Today 3-year-old Amanda is going for her first flight on an airplane. As the engines begin to roar, the plane vibrates as it picks up speed, and as it finally lifts off the ground, she looks at her mother's expression. Her mother is smiling as she looks out of the window, so Amanda decides everything is okay, and flying is fun, and then she begins smiling herself. This is an example of: