After taxes, Jess takes home a salary of J = $5000 every month. She pays P percent of this to her rent and all her fixed bills each month, leaving her with K left. She spends half of K on groceries, leaving her with L left. If she spends 1331 of L on gifts and puts 2552 of L into her savings account, this would leave her with $200 for miscellaneous expenses. What is the value of P?

Answers

Answer 1

Using percentage, the correct answer is "The value of P is $3,500 and it corresponds to 70% of her salary".

Define percentage?

The denominator of a percentage, also known as a ratio or a fraction, is always 100. For instance, Sam would have received 30 points out of a possible 100 if he had received a 30% on his maths test. In ratio form, it is expressed as 30:100, and in fraction form, as 30/100. Here, "percent" or "percentage" is used to translate the percentage symbol "%." The percent symbol can always be changed to a fraction or decimal equivalent by using the phrase "divided by 100".

First, we need to calculate L.

1/3 or 33.33% of L spend on gift.

2/5 or 40% of L spent on savings.

This would leave her with $200 for miscellaneous expenses:

= 100% - (33.33% + 40%)

= 100% - 73.33%

= 26.67%

So, 26.67% = $200 for miscellaneous expenses

Rule of three, to calculate L.

26.67% is $200.

100% will be:

= (100 X 200) ÷ 26.67

= 20000 ÷ 26.67

= $750

L= $750

Now we going to calculate K.

"K is twice the amount of L".

K = L X 2

K = 750 X 2

K= $1,500

Finally, we going to calculate P.

P = J - K

J = $5,000

K = $1,500

P =$5,000 - $1500

= $3,500

Rule of three

5000 is 100%

3500 will be:

= 3500 x 100 ÷ 5000

= 350000 ÷ 5000

P = 70%

The value of P is $3,500 and it corresponds to 70% of her salary.

To know more about percentage, visit:

https://brainly.com/question/24159063

#SPJ1


Related Questions

A union of restaurant and foodservice workers would like to estimate the mean hourly wage, u, of foodservice workers in the U.S. The union will choose a random sample of wages and then estimate u using the mean of the sample. What is the minimum sample size needed in order for the union to be 90% confident that its estimate is within $0.45 of u? Suppose that the standard deviation of wages of foodservice workers in the U.S. is about $2.20.

Answers

Union will need to choose a random sample of at least 65 wages to be 90% confident that its estimate of the mean hourly wage of foodservice workers is within $0.45 of the true population mean.

What is the minimum sample size needed?

To calculate the minimum sample size needed for the union to be 90% confident within $0.45 of the true population mean, we can use the formula which states n = (Z^2 * σ^2) / E^2

Z = 90% = 1.645

σ = $2.20

E = $0.45

Substituting the values, we get:

n = (1.645^2 * 2.20^2) / 0.45^2

n = 13.097161 / 0.2025

n = 64.6773382716

n = 64.678

n = 65

Read more about sample size

brainly.com/question/17203075

#SPJ1

A desk is being sold for $129.60. This is a 76% discount from the original price. What is the original price?

Answers

Answer:

170.52

Step-by-step explanation:

Let x be the original price

Then,

129.60 = 76% of x

129.60 = 76/100 * x

12960/76 = x

x = 170.52

place the indicated product in the proper location on the grid (b^2+8)(b^2-8)​

Answers

The final product of the given algebraic expression is: b⁴ - 64

How to expand algebraic expressions?

Algebraic expressions are defined as simply the idea of expression of numbers using letters without specifying their actual values. The basics of algebra taught us how to express an unknown value using letters such as a, b, c, etc. These letters are referred to as variables. An algebraic expression can be a combination of both the variables and the constants. Any value that is placed before and multiplied by a variable is a coefficient.

The expression is given as:

(b² + 8)(b² - 8)

Expand the expression using (a + b)(a - b) = a² - b²

Thus:

(b² + 8)(b² - 8) = b⁴ - 64

Thus, that is the final product of the given algebraic expression.

Read more about Algebraic expressions at: https://brainly.com/question/4344214

#SPJ1

Assume that 1,500,000 people take the SAT each year and their scores form a normal distribution. If Mike scores two standard deviations above the mean, what percentile is he?

Answers

If Mike scores two standard deviations above the mean then the Mike's percentile-score is 97.72 ≈ 98 percentile.

What is the percentile score.

The percentile score corresponding to a raw test score, is the probability of the test score of a randomly chosen student to be less than or equal to the given test score.  To calculate this probability we find the value of the cumulative distribution function of the test score random variable at the given test score.

How do we calculate the percentile score in the case when, the test scores  have a normal distribution.

To calculate the percentile score of the given raw test score we have to find the value of the cumulative distribution function for the test score random variable at the given raw test score. if this random variable is X, then the linearly scaled random variable [tex]Z=\frac{X-\mu}{\sigma}[/tex], has standard normal-distribution. here [tex]\mu\textrm{ and }\sigma[/tex] are the mean and the standard deviation of the test score r.v respc. Also [tex]\textrm{P}(X\leq x_0) = \textrm{P}(Z\leq z_0),\textrm{ where }z_0=\frac{x_0-\mu}{\sigma}[/tex].  So instead of finding [tex]\textrm{P}(X\leq x_0)\textrm{, we can find } \textrm{P}(Z\leq z_0)[/tex] instead. [tex]z_0[/tex] is called the z-score corresponding to the [tex]x_0[/tex]. We can find [tex]\textrm{P}(Z < z_0)[/tex], using the table for the standard normal distribution.

For our question, we want to find [tex]\textrm{P}(X\leq \mu + 2\sigma)[/tex]. which is equal to [tex]\textrm{P}(Z\leq \frac{\mu+2\sigma - \mu}{\sigma}) = \textrm{P}(Z\leq 2).[/tex] So the z-score = 2. From the table for the standard normal distribution we get [tex]\textrm{P}(Z\leq 2) = .9772[/tex]. So our percentile score is .9772 or 97.72% [tex]\sim[/tex] 98%.

To know more about percentiles, visit:

https://brainly.com/question/1594020

#SPJ1

What is the volume of the rectangular prism?

A rectangular prism where the area of the base is 24 square inches and the height is 6 inches.

150 in.3
144 in.3
132 in.3
120 in.3

Answers

The volume of the rectangular prism is 144 in³ with the area of the base is 24 square inches and the height is 6 inches.

What is volume?

Volume is a measure of the amount of physical space occupied by an object or a fluid.

This is because the volume of a rectangular prism can be calculated by the formula V = A x h, where V is the volume, A is the area of the base, and h is the height. In this problem, the area of the base is 24 square inches and the height is 6 inches.

Therefore, the volume of the rectangular prism can be calculated as follows:

V = 24 in² x 6 in

= 144 in³

It is important to note that the formula for calculating the volume of a rectangular prism can be used for any rectangular prism, regardless of the size of the area of the base and the height. The formula remains the same and the only thing that changes is the numbers that are used to calculate the volume.

For more questions related to rectangular prism

https://brainly.com/question/24284033

#SPJ1

The diagonal of the floor of a rectangular office cubicle is 4 ft longer than the length of the cubicle and 3ft longer than twice the width. Find the dimensions of the cubicle.

Answers

The dimensions of the cubicle are 31.97 and 16.5 respectively.

How to calculate the dimensions

We make diagram of rectangular office and AB is diagonal

let L be length and E be width

From the information, the diagonal of the floor of a rectangular office cubicle is 4 ft longer than the length of the cubicle and 3ft longer than twice the width.

As given  diagonal of the floor of a rectangular office cubicle is 4 ft longer than the length L.

So D = l + 4

D² = L² + W²

(D - 4)² + (D - 3)² / 4 = D²

Simplifying further, the dimensions of the cubicle are 31.97 and 16.5 respectively.

Learn more about dimensions on

https://brainly.com/question/26740257

#SPJ1

b) Draw a vertical y-axis on the left-hand side of your graph and label it. Then draw a horizontal x-axis at the bottom of your graph. Then label the coordinates of each corner of the sign on your graph. Draw line a on your graph. What is the slope of line a?

Answers

The line an illustrates a linear function. Line a's slope is thus 1. Y = x + 2 is the equation for the line 'a'.

What is a slope of line?

The steepness or slant of a line may be determined by looking at its slope. The slope is defined as the ratio of any two points on the line's vertical change (rise) to its horizontal change (run). The letter "m" is typically used to indicate slope.

The slope of a line connecting the coordinates (x1, y1) and (x2, y2) may be determined mathematically using the following formula:

[tex]m=\frac{y_{2}-y_{1} }{x_{2} -x_{1} }[/tex]

Now, Evaluating slope of line 'a';

[tex]m=\frac{4-2 }{2-0 } = \frac{2}{2} =1[/tex]

Hence, the slope of line 'a' is 1.

Final Plotted Graph is mentioned in image 3 attached.

Learn more about Slope of Line here:

https://brainly.com/question/14511992

#SPJ1

Complete Question : Draw a vertical y-axis on the left-hand side of your graph and label it. Then draw a horizontal x-axis at the bottom of your graph. Then label the coordinates of each corner of the sign on your graph(Refer to image attached). Draw line a on your graph. What is the slope of line a?

How would you express the Raptors’ wins to games played as a ratio?
Soccer season = 35 games
Raptors: Played 10, Won 6

Answers

Answer:

3:5 or 3 to 5 or [tex]\frac{3}{5}[/tex]

Step-by-step explanation:

[tex]\frac{6}{10}[/tex] ÷[tex]\frac{2}{2}[/tex] = [tex]\frac{3}{5}[/tex]

Helping in the name of Jesus.

Need help with questions 3, 5, and 6.

Answers

Answer:

1. 16

2. 9

3. 21.08

Step-by-step explanation:

1. (explanation) (x+b)^2 = x^2+2bx + b^2 ( square formula)

16, would make a square trinomial

Answer:

1.16

2.9

3.x=9+root of 146(12.08) or x=9-root of 146

marking as brainlist!!! pls help

Answers

The measure of the angle ∠6 is 102 degrees for the given parallel lines.

What are supplementary angles?

Two angles are said to be supplementary if their sums equal 180 degrees. In other words, if angles A and B are complementary, then the sum of the two angles is 180 degrees. Four angles are created when two lines intersect; if two of these angles are supplementary, the other two are likewise supplementary.

Since 70 + 110 = 180 degrees, 70 degrees and 110 degrees serve as an illustration of a pair of supplementary angles. Another illustration is a pair of vertical angles, which are always supplementary and are generated by the intersection of two lines.

The measure of angle of a straight line is given as 180 degrees.

Thus,

∠6 + 78 = 180

∠6 = 180 - 78

∠6 = 102

Hence, the measure of the angle ∠6 is 102 degrees for the given parallel lines.

Learn more about supplementary angles here:

https://brainly.com/question/18164299

#SPJ1

Which matrix represents the system of equations shown below?
4x - 5y = 4
5x-2y=-16
A
4x -5y 4
5x -2y-16
B
4 -5 4
16] [1 46] [4
5 -2-16
C
D
541 5 4 4
][
-5-2-16-2-5-16

Answers

Answer:

it's for sure d please mark me as a brainliest

How do I find the matrix A?

Answers

The matrix of A is [tex]A = \left[\begin{array}{ccc}0&0&-6\\9&0&0\\0&0&0\end{array}\right][/tex]

Let's start by considering the first standard basis vector [1 0 0]. Applying the transformation T to this vector gives:

T([1 0 0]) = [0 9 -6] * [1 0 0] = [0 0 0]

Therefore, the image of [1 0 0] under T is the zero vector [0 0 0]. Since the image of the first standard basis vector is the first column of the matrix A, we know that the first column of A is the zero vector.

We can follow the same process to find the image of the second standard basis vector [0 1 0]:

T([0 1 0]) = [0 9 -6] * [0 1 0] = [0 9 0]

Therefore, the image of [0 1 0] under T is the vector [0 9 0]. Since the image of the second standard basis vector is the second column of the matrix A, we know that the second column of A is [0 9 0].

Finally, we find the image of the third standard basis vector [0 0 1]:

T([0 0 1]) = [0 9 -6] * [0 0 1] = [-6 0 0]

Therefore, the image of [0 0 1] under T is the vector [-6 0 0]. Since the image of the third standard basis vector is the third column of the matrix A, we know that the third column of A is [-6 0 0].

Putting it all together, the matrix A of the linear transformation T (x) = v * x is:

[tex]A = \left[\begin{array}{ccc}0&0&-6\\9&0&0\\0&0&0\end{array}\right][/tex]

In conclusion, we can see that the matrix A captures how the linear transformation T maps each standard basis vector in R³. By applying this matrix to any vector in R³, we can efficiently compute the image of that vector under T.

To know more about matrix here

https://brainly.com/question/28180105

#SPJ1

Answer this simple question for big reward please

Answers

Answer:

The answer is C. 24, 9, -11, -24, -33.

In this list, 24 is the greatest integer, followed by 9, then -11, then -24, and finally -33. The other options are not in order from greatest to least.

Step-by-step explanation:

Answer:

The answer is C. 24, 9, -11, -24, -33.

In this list, 24 is the greatest integer, followed by 9, then -11, then -24, and finally -33. The other options are not in order from greatest to least.

Step-by-step explanation:

I need help pleaseeee I’m confused on all if anyone out there could help please do!!!

Answers

Answer:

Hilltop

Step-by-step explanation:

Convert all to meters,

Mammoth- 8005 meters

Brookside- 8700 meters

Wild Rose- 8080 meters

Hilltop- 8800 meters.

Hilltop has the most meters, it is the longest.

CAN SOMEONE HELP WITH THIS QUESTION?

Answers

a. From the graph a = 1 and b = 1

b. f(x) = -x/4 + 5

c. The area under the graph is 9 units²

How to find the area under the graph?

a. First to find the area under the graph, we find the values of a and b. From the graph, a = 1 and b = 3

b. To find f(x), we note that f(x) is a straight line. So, using the equation of a

in slope form, we have that

(y - y')/(x - x') = (y" - y')/(x" - x') where

x' = 0, x" = 4, y' = 5 and y" = 4.

So, substituting the values of the variables into the equation, we have that

(y - y')/(x - x') = (y" - y')/(x" - x')

(y - 5)/(x - 0) = (4 - 5)/(4 - 0)

(y - 5)/x = -1/4

y - 5 = -x/4

y = -x/4 + 5

So, f(x) = -x/4 + 5

c. To find the area under the curve, we notice that ∫f(x)dx = area

So, ∫f(x)dx = ∫₁³(-x/4 + 5)dx

= ∫₁³(-xdx/4) +  ∫₁³5dx

= [-x²/(2 × 4)]₁³ + [5x]₁³

= [-x²/8]₁³ + [5x]₁³

= [-3²/8 - (-1)³/8] + 5[3 - 1]

= [-9/8 + 1/8] + 5[2]

= -8/8 + 10

= -1 + 10

= 9 units²

Learn more about area under graph here:

https://brainly.com/question/29600968

#SPJ1

Find the x-intercept and the y-intercept 7x-3y=21

Answers

y-int= -7 , x-int= 3
y-intercept:

Plug in 0 for 'x' to find the y-intercept:

[tex]7x - 3y = 21[/tex]

[tex]7(0) - 3y = 21[/tex]

[tex]0 - 3y = 21[/tex]

[tex]-3y = 21[/tex]

Divide -3 to both sides:

[tex]y = -7[/tex]

So the y-intercept is -7.

x-intercept:

[tex]7x - 3y = 21[/tex]

Plug in 0 for 'y' to find the x-intercept.

[tex]7x - 3(0) = 21[/tex]

[tex]7x - 0 = 21[/tex]

[tex]7x = 21[/tex]

Divide 7 to both sides:

[tex]x = 3[/tex]

So the x-intercept is 3.

Which are correct representations of the inequality –3(2x – 5) < 5(2 – x)? Select two options.

Answers

The correct representations of the inequality –3(2x – 5) < 5(2 – x) are x > 5 and x > 5

Selecting the correct representations of the inequality

From the question, we have the following parameters that can be used in our computation:

–3(2x – 5) < 5(2 – x)

Open the brackets

So, we have

-6x + 15 < 10 - 5x

Evaluate the like terms

So, we have

-x < -5

This gives

x > 5

Hence, the correct representations of the inequality are x > 5 and x > 5

Read more about inequality at

https://brainly.com/question/30422919

#SPJ1

Find the missing length

Answers

[tex]\cfrac{9}{x}=\cfrac{6}{10}\implies \cfrac{9}{x}=\cfrac{3}{5}\implies 45=3x\implies \cfrac{45}{3}=x\implies 15=x[/tex]

Need help with this page 20 points

Answers

Answer:

14. D) x+25=50; when x=157, x+25=182, which is equal to 50.

15. a) 3; you can solve for r by isolating the variable on one side of the equation. First, add 21 to both sides to get 10g - 21 + 21 = 7r + 12 + 21. Simplify to get 10g = 7r + 33. Then, subtract 33 from both sides to get 10g - 33 = 7r. Finally, divide both sides by 7 to get r = (10g - 33)/7. Plugging in a value for g, such as 3, gives you r = 3.

16. C) 2; combine like terms on both sides of the equation to get r - 8 = 8r + 10. Then, isolate the variable by subtracting r from both sides to get -9r - 8 = 10. Next, add 8 to both sides to get -9r = 18. Finally, divide both sides by -9 to get r = -2.

17. a) -36; start by isolating the variable on one side of the equation. Add 18 to both sides to get m/3 = m + 24. Then, subtract m from both sides to get -2m/3 = 24. Next, multiply both sides by -3/2 to get m = -36.

Step-by-step explanation:

Mark Brainliest!!

A sofa is being sold for 65% off the regular price . the sale price is $247 what is the regular price?

Answers

Answer:

$705.71

Step-by-step explanation:

Let's assume the regular price of the sofa is "x".

According to the problem statement, the sale price is 65% off the regular price, which means the sale price is equal to 35% of the regular price.

We can write this relationship as:

0.35x = $247

To find the value of "x", we need to solve for "x" in the above equation.

Dividing both sides by 0.35, we get:

x = $247 ÷ 0.35

x = $705.71

Therefore, the regular price of the sofa is $705.71.

A newscaster earns $31,800 and wants to invest 10% of his/her monthly salary to save for retirement in 24 years. If he/she invests this money at 5.5% compounded monthly, how much money will he/she have at retirement? a) How much will be saved each year? $ b) What will be the monthly deposit? $ c) What will be the amount in the account after 24 years? $

Answers

Answer: a) The amount saved each year will be 10% of the annual salary, which is:

10% x $31,800 = $3,180

b) the monthly deposit will be $265.

c) the amount in the account after 24 years will be $76,046.92.

Step-by-step explanation:

Sarah runs a small business employing 12 members of staff. Each of Sarah's employees works from 08:30 - 17:00 Sarah pays her workers £8.75 per hour. Calculate Sarah's daily outgoings on wages.

Answers

Sarah's daily outgoings on wages are £892.50.

What is wages?

Wages refer to the payment made to an employee in exchange for their labor or services provided to an employer. It is usually paid on an hourly, daily, weekly or monthly basis, and the amount of wages earned is determined by the hours worked, rate of pay, and any applicable deductions or taxes. Wages can be paid for various types of work, such as manual labor, skilled trades, clerical work, or professional services. It is an essential component of an employee's compensation package and is regulated by labor laws to ensure that employees are fairly compensated for their work.

Each employee works for 8.5 hours a day (17:00 - 08:30 = 8.5). So, the total number of hours worked by 12 employees in a day is 12 employees × 8.5 hours/employee = 102 total hours

Sarah pays each employee £8.75 per hour, so her total daily outgoings on wages can be calculated as,

102 total hours × £8.75 per hour/employee = £892.50

Therefore, Sarah's daily outgoings on wages are £892.50.

Learn more about wages here,

https://brainly.com/question/27126630

#SPJ1

I'm not sure if I'm right for the answer for 4% so can anyone help pls.

I got 0% but I'm pretty sure that's wrong.

I got 8500 for 2%

Answers

Rachel $8500 invested at 4% and $8800 invested at 2% interest rate.

Define the term Investment?

Investment is the act of allocating money or resources with the expectation of generating income or profit in the future.

Let x be the amount invested in the second account (with a 4% interest rate).

Then, since Rachel invested $300 more in the first account, the amount invested in the first account (with a 2% interest rate) is (x + 300)

We know that the total interest income Rachel earned was $516. We can set up an equation using the interest formula: (2% means 0.02 and 4% means 0.04)

⇒ 0.02(x + 300) + 0.04x = 516
⇒ 0.02x + 6 + 0.04x = 516
⇒ 0.06x + 6 = 516
⇒ 0.06x = 510
⇒ x = 8500

So, Rachel invested $8500 in the second account (with a 4% interest rate)

and (x + 300) = (8500 + 300) = $8800 in the first account (with a 2% interest rate).

Therefore, Rachel $8500 invested at 4% and $8800 invested at 2%.

To know more about investment, visit:

https://brainly.com/question/27717275

#SPJ1

There are four rational numbers which are listed smallest to largest, A, B, C, and D.
If the numbers are 5/3, 7/15, 6/10, and 25/5 identify which is A, which is B, which is C, and which is D.

Answers

Okay, let's list the 4 rational numbers from smallest to largest:

5/3

7/15

6/10

25/5

So:

5/3 is A

7/15 is B

6/10 is C

25/5 is D

Plot -2 1/6 and 11/6 on the number line below.

Answers

The given rational numbers are marked on number line below.

The given numbers are [tex]-2\frac{1}{6}[/tex] and 11/6.

We need to plot the given numbers on number line.

A number line is a visual representation of numbers on a straight line. This line is used to compare numbers that are placed at equal intervals on an infinite line that extends on both sides, horizontally or vertically.

Hence, the given rational numbers are marked on number line below.

Learn more about the number line here:

https://brainly.com/question/13425491.

#SPJ1

Chi Square Test
. A six-sided die is rolled 120 times. Fill in the expected frequency column. Then, conduct a goodness-of-fit test to determine if the die is fair. The table below shows the result of the 120 rolls.
Face Value |. Frequency. |. Expected Frequency
1. | | 15 |
2. | | 29 |
3. | |. 16 |
4. | |. 15 |
5. | |. 30 |
6 | | 15 |

Answers

Expected frequency of each face value is 20 and we can reject the null hypothesis that the die is fair.

To conduct a goodness-of-fit test for the fairness of the die, we need to first determine the expected frequency of each face value assuming the die is fair. Since there are six equally likely outcomes for a fair die, the expected frequency of each face value is 120/6 = 20.

Thus, we can complete the expected frequency column in the table as follows:

Face Value            Frequency          Expected Frequency

1                                  15                                20

2                                 29                               20

3                                 16                                20

4                                 15                                20

5                                 30                                20

6                                  15                                20

We can then calculate the chi-squared statistic using the formula:

χ² = Σ[(O - E)² / E]

where O is the observed frequency and E is the expected frequency.

Substituting the values from the table, we get:

χ² = [(15-20)²/20] + [(29-20)²/20] + [(16-20)²/20] + [(15-20)²/20] + [(30-20)²/20] + [(15-20)²/20]

χ² = 4.75 + 2.25 + 1 + 4.75 + 5 + 4.75

χ² = 22.25

The degrees of freedom for this test is (6-1) = 5. Using a chi-squared distribution table with 5 degrees of freedom and a significance level of 0.05, we find the critical value to be 11.07.

Since the calculated chi-squared value of 22.25 is greater than the critical value of 11.07, we can reject the null hypothesis that the die is fair. Therefore, we have evidence to suggest that the die may be biased.

To learn more about frequency click on,

https://brainly.com/question/24098145

#SPJ1

Find what percent of the perfect squares less than 1000 that end in a 6. (Don't forget that zero is a perfect square)

Answers

The perfect square is the integer that can be expressed as the square of another integer. Moreover, it is said to be the product of some integer with itself.

To see the percent of the perfect squares less than 1000 that end in a 6. Let us see the perfect squares under 1000.

Perfect squares  < 1000

0, 1, 4, 9, 16, 25, 36, 49, 64, 81, 100, 121, 144, 169, 196, 225, 256. 289, 324, 361, 400. 441. 484, 529. 576, 625, 676, 729, 784, 841, 900, 961

Hence, there are 32  perfect squares less than 1000 in which,

6  end  in a "6"

So

6  / 32 = 3/ 16   = 18.75 %

Therefore 18.75% percent of the perfect squares are less than 1000 that end in a 6.

To learn more about perfect squares,

brainly.com/question/13521012

brainly.com/question/385286

Pls help math problem

Answers

+) tri1 = 2×3 = 6 (cm²)

+) tri2 = 3×4 = 12 (cm²)

+) area of this shape = tri1 + tri2 = 6+12 = 18 (cm²)

Ans: 18cm²

ok done. Thank to me >:333

13.5 ft2 = _______ yd2

Answers

Answer:

4.5

Step-by-step explanation:

uh

Solve the equation by completing the square. The equation has real number solutions.
x² + 12x = -32
X=

Answers

Answer:

X = -8 X= -4

Step-by-step explanation:

x² + 12x = -32

(x + 12/2)² = -32 + (12/2)²

(x + 6)²= 4

square root both sides

x + 6 = 2

x + 6 = -2

x=-8 x=-4

Other Questions
Suppose that two threads have several critical sections, protected by different mutexes. The following are two of those critical sections, with their protection code. code segment 1 lock(m1); ... /* code protected by m1 */ lock(m2); ... /* code protected by m2 */ unlock(m2); unlock(m1) code segment 2 lock(m2); ... /* code protected by m2 */ lock(m1); ... /* code protected by m1 */ unlock(m1); unlock (m2). Is that a sensible way to protected this critical code? Select one: O True O False Match the following. Match the items in the left column to the items in the right column.1. set builder notation2. element3. set4. line graph5. inequality6. real numbera shorthand way to write a set(less than), (greater than), (less thanor equal to), (greater than or equal to)visual tool used to illustrate solutionsetsa collection or group of objectsindicated by braces, (a member of a setpositive or negative, rational orirrational numbers including zero The addition of concentrated nitric acid to each standard solution... Select all that are True. O results in a relatively constant ionic strength across the standard solutions. O results in the required amount of excess nitrate ion. O changes the potential of the reference electrode. O results in an ultraviolet digestion to ensure sample dissolution. O results in a wet acid digestion to ensure sample dissolution. Unit 9 lesson1 7th grade math math nation pt.2 Can somebody do this, please?! 10. describe three similarities between mitosis and meiosis. a. 11. describe three ways the outcome of mitosis and meiosis differ. a first order reaction has a rate constant of 1.10 x 10-4 s-1 at 470oc, and 5.70 x 10-4 s-1 at 500oc. what is the activation energy for the reaction?a. 260 kJ/mol b. 46 kJ/mo c. 110 kJ/mol d. 380 kJ/mol The French experience in New France was similar to the Spanish experience in New Mexico in all of the following ways, EXCEPT...Group of answer choicesImperial influence was expanded by conquering native peoplesLow level immigrationDependence upon the native peoplesInter-racial marrying and social integration Express cos M as a fraction in simplest terms. Multiple energy storage methods are in use around the world. Pumped hydroelectric is a common energy storage method in the United States that pumpswater into a storage pond raised above another water source and then allows the water to flow downhill through a turbine to generate electricity. How is theenergy stored in pumped hydroelectric facilities?O as kinetic rotational energyO as stored chemical energyO as thermal energyO as gravitational potential energy When light enters and leaves the prism, its path is changes because the light is _____ at the boundary between the glass and the airA. Absorbed B. DiffractedC. ReflectedD. Refracted Sheridan Company is considering an investment that will return a lump sum of $929,000 6 years from now. CWhat amount should Sheridan Company pay for this investment to earn an 8% return? (Round answer to 2 decimal places, eg. 25.25.)Lincoln Company should pay $ ___Wildhorse Co.earns 8% on an investment that pays back $87,000 at the end of each of the next 6 years.What is the amount Wildhorse Co. invested to earn the 8% rate of return? (Round answer to 2 decimal places, eg. 5,275.25.) Wildhorse Co. invested $ ___ compare and contrast the expansionist policies of the russian state with those pursued by the british and french regimes during this period. let x have the following cumulative distribution function (cdf): f(x)={0,x Gary deposited $9,000 in a savings account with simple interest. Four months later, he had earned $180 in interest. What was the interest rat (conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil? Which of the following statements is the best description of the per capita generation of solid waste between 1960 and 2010?ANSWER:a.Between 1960 and 2010, per capita generation was relatively constant.b.Between 1960 and 2010, per capita generation of solid waste increased steadily.c.Between 1960 and 2000, per capita generation increased.After 2000, per capita generation declined.d.Between 1960 and 1990, per capita generation increased at a steady rate. After 1990, per capita generation continued to increase, but at a slower rate.