An example of a word we now use that originated in science fiction literature
is
A. spaceship
B. headphones
C. evolution
D. translator

Answers

Answer 1
I think the answer is : A

Related Questions

Answer please of that

Answers

Answer:

1- of

2- on

3- sacrificed

4- given

5- who

of

on

sacrificed

given

who

this is ur answer friend hope it help u

Evaluate.

(x + 4) · 2³ - x for x = 6

0
14
54
74

Answers

Answer:

74

Explanation:

Gauge
old
Directions: Choose one from the given situation. Write a wise
inference, a reaction, or a conclusion in a form of a short
paragraph that consist of 3-5 sentences.
1. Anthony was smiling, having claimed a package from the
delivery man outside their door.
2. The church was full of happy parishioners; there were even
families outside unusually complete to hear the mass that
day.​

Answers

Answer:

dmm

Explanation:

sm

Activity 3: Reduce Stress
LEAD IN: Crossword puzzle
Look at the pictures, unscramble the correct action and complete the crossword
ACROSS
1
1.1 (AWRD)
2. I (PHEL)
3. OD
my grandfather
DOWN:
4.1 (EARD
books​

Answers

I looked this question up and found it online. Even without the crossword puzzle, we can answer it because of the hint sentences. They are as follows:

1. I ________ pictures.

2. I ________ my grandfather.

3. I ________ exercises.

4. I ________ books.

Answer:

1. I draw pictures.

2. I help my grandfather.

3. I do exercises.

4. I read books.

Explanation:

For this question, we need to both unscramble the verbs and decide where they go.

If by looking at the scrambled letters you find it difficult to figure out what word they spell out, the best strategy is to read the sentences. They offer context. For example, suppose you couldn't figure out EARD. When you see "I _______ books," you will quickly realize that EARD spells READ because what we usually do with books is read them. The same works for the other sentences.

All of the following are important things one should do during a lecture except: O A. listen for repetition B. write out lecture notes word for word. C. look for body language cues and listen for verbal cues. O D. pay attention to signal words.​

Answers

A because why would you need to pay attention to that

The following are important things one should do during a lecture except listen for repetition.

What is repetition?

When a single word or phrase is used repeatedly in rapid succession for effect, this is known as repetition. It can support highlighting a point. For instance, "I have to practice my time's tables over" as opposed to "I have to practice my time's tables over and over and over again" will help you remember your time's tables.

Using the same word or phrase again in writing or speaking is a literary tactic known as repetition. Repetition is a technique used by writers of various genres, although it is especially common in oratory and spoken word, where a listener's attention span may be shorter.

It is best to read assigned readings and download the lecture notes prior to class to become ready for a lecture. Without having studied for a lesson, you are more likely to find it difficult to comprehend new material.

Therefore, Thus, option (A) is correct,

Learn more about repetition here:

https://brainly.com/question/28084537

#SPJ2

Select the correct answer.
Why is Pat Scully a master of strategy?

A.
He was trained as a classical painter.
B.
He painted the hotel the color found on the legs of a heron.
C.
He built the hotel between the train and the town.
D.
He painted the hotel an eye-catching color.

Answers

By choosing his paints, the OWNER, Pat Scully, demonstrated his skill as a cunning tactician.

Why is Pat Scully such a genius at planning?

It's true that on bright days when the big express trains SWEPT past Fort Romper, the show would frequently be too much for the passengers to handle. It was absurd to expect that anyone would stroll by the Palace Hotel without having a look, especially since the traveler had to pass through it when he got off the train at the station before he could see the collection of humble clapboard homes that comprised up Fort Romper.

What was accomplished by Pat Scully?

Yes, on clear days, when the big transcontinental expresses with their long lines of swaying Pullmans passed by Fort The image completely overwhelmed the travelers, and the cult that is accustomed to the brown-reds and subcategories of the dark greens of the East laughed in humiliation, sorrow, and horror. But, in the eyes of the people who lived in this prairie town and the onlookers who would inevitably stop there, Pat Scully had succeeded.

To know more about Pat Scully visit:

https://brainly.com/question/25575273

#SPJ1

Which statement provides the best definition of a comparative literature claim?
a statement of the author's opinion regarding why he or she prefers the literature of one culture over that of another
a debatable generalization about the similarities and differences between literature from two different cultures
a list of the similarities and differences of literature from two different cultures supported by the author's opinion
a summary of facts about two different cultures that have produced similar literature, even though they are far apart geographically

Answers

Answer:

a debatable generalization about the similarities and differences between literature from two different cultures.

Explanation:

A claim can be defined as a statement that is used by a writer to prove, substantiate or support an argument. Thus, a claim is an assertive statement expressed by a writer to prove that an argument is true or real.

This ultimately implies that, when writers engage in an argument or write an argumentative essay, they make use of a claim to state or express their opinions about the subject matter or topic.

A comparative literature claim involves the use of available informations to illustrate the differences and similarities i.e comparing and contrasting two different things, so as to reach a logical conclusion.

Hence, the statement which provides the best definition of a comparative literature claim is a debatable generalization about the similarities and differences between literature from two different cultures.

Imagine that you think someone close to you, such as a friend or family member, nas mental illness . How do you think you would react?

Please help

Answers

Answer:

I would suggest encouraging them to seek out a psychologist. Whatever happens, make sure that you talk to this individual about their mental illness in a way that lets them know they are valid, that you understand their pain, and that they are NOT crazy or insane. If they need to talk, don't shut them down or invalidate their feelings in any way, such as saying "everyone feels like that at some point or another." Although that kind of comment may seem comforting to you, it makes the individual feel misunderstood and hurt. And if they don't want to talk, don't force them, but make sure they know that it is safe to talk to you, and you will not judge them or condemn them in any way. Let this person know you care about them. Good luck, and as a person with a mental illness, feel free to DM me if you have any further questions throughout the process.

-WRITE THE FOLLOWING SENTENCES AND WRITE THE CORRECT
NTUATIONS:
1. Our teacher said we must bring socks shoes t-shirts and shorts
2. I wanted to take biscuits sweets fruits and chips for the
journey​

Answers

Answer:

1. Our teacher said we must bring socks, shoes, t-shirts, and shorts.

2. I wanted to take biscuits, sweets, fruits, and chips for the

journey​.

Explanation:

Comma (,) is used to separate the items in a list. In the above sentences several items are listed. These items ought to be separated to be more understandable to the reader. In the first sentence, items such as socks, shoes, t-shirts, and shorts are listed. To be more understandable to the reader a comma is inserted after each item is mentioned.

Full stops or Periods are used to signify the end of a sentence. They were also missing in the above sentences.

infer what is primary problem of heating on earth atmosphere and how would you solve this problem?

Answers

The primary problem is the greenhouse effect. Greenhouse effect is when some gases (including CO2) absorbs some portion of sun's heat to make the atmosphere warm to support life. But when the amount of CO2 etc. increases in the atmosphere, it heats up more than it is required. So, by limiting CO2 emission, we can solve this problem.

What kind of sentence is Callie loves playing video games her favorite games are mincraft and Mario kart.

Answers

Answer:

A run-on sentence.

Explanation:

Which of Juliet’s lines best shows her respect for her mother?

Answers

Answer:

I’ll look to like, if looking liking move”.

Explanation:

this shows that she wants to please her mother even though she doesn't want to get married to Paris

Need help please, It's urgent, which quote to support the idea....
Read the excerpt below from "Icarus" by Jean Lang.
In terror Icarus's father Daedalus watched him, and as Daedalus called to him in a voice of anguished warning that was drowned by the whistling rush of the air currents through the wings of Icarus, and there befell the dreaded thing. It seemed as though the strong wings had begun to lose their power. Like a wounded bird Icarus fluttered, lunged sidewise from the straight, clean line of his flight, recovered himself, and fluttered again. And then, like the bird into whose soft breast the sure hand of a mighty archer has driven an arrow, downwards he fell, turning over and yet turning again, downwards, ever downwards, until he fell with a plunge into the sea that still was radiant in shining emerald and translucent blue.
Then the car of Apollo drove on. His rays had slain one who was too greatly daring, and now they shone on the little white feathers that had fallen from the broken wings and floated on the water like the petals of a torn flower.
Stricken at heart was Daedalus, but there was no time to lament his son’s untimely end, for even now the ships of Minos might be in pursuit. Onward he flew to safety, and in Sicily built a temple to Apollo, and there hung up his wings as a propitiatory offering to the god who had slain his son.
Which quote best supports the idea that Icarus was reckless?
a) "Onward he flew to safety, and in Sicily built a temple to Apollo."
b) "His rays had slain one who was too greatly daring."
c) "Then the car of Apollo droveon."
d) "It seemed as though the strong wings had begun to lose their power
Note: I confused between b) and d)....

Answers

Answer:

Hey, this may be really late...but I'm going through the English section on brainly and found your question...

Your answer is B. "His rays had slain one who was too greatly daring."

Explanation:

Before this quote the story goes, "Then the car of Apollo drove on." This "car" is actually the sun chariot which Apollo drives. The quote is saying that the sun's rays killed Icarus for "being too daring". This is concluded because he wanted to keep flying higher and higher until he got too close to the sun.

Sir gawain and the green knight match the words in their correct definitions

Answers

6.

The probability that Alex wins on Mario Kart is 0.3. He plays 4 games in a row. How likely is he?

a) win all matches?

b) lose all matches?

c) win three of the matches?

Which narrative technique does go to use to slow the pace of the story in his passage

Answers

Answer:

A. Complex sentences.

Explanation:

They make a sentence longer.

Hope this helps!

"A tone of moral virtue filled his speech / And gladly he would learn, and gladly he would teach.”

Which character is represented by this quotation?


the Monk

the Pardoner

the Parson

the Oxford Cleric

Answers

Answer:

The Oxford Cleric

Explanation:

None needed. More of a duh :)

Explanation:

[tex]oxford \: cleric \\ thank \: you[/tex]

each of the boys____ here on time yesterday.fill it​

Answers

Answer:

got

Explanation:

each of the boys got here on time yesterday.

Scramble the word GONL​

Answers

Long is the answer ur welcome lil bro

Answer:

long

Explanation:

a paragraph that uses vivid sensory details to allow the reader to experience what is being described

Answers

I honestly hope that this helps you.

The following are reasons why an
opinion writer should not
overanalyze the topic except which
one?
A. The audience can't handle more than one opinion
and analysis of the topic.
B. The audience is not interested in reading about
an idea which has been fully developed.
C. The writer is allowing the audience to think more
about the topic for themselves.

Answers

Definitely b I’m pretty sure

Reasoning through Langu A solution to the problem of food deserts seems obvious: more supermarkets should be built in low-income neighborhoods. The problem with this solution, of course, is that it is difficult to lure supermarket chains into poor areas. Be- cause poorer people have less money to spend on food, supermarket chains do not consider them to be attractive customers. One way that the government can help to offset this issue is by offering tax breaks or other incentives for supermarkets in low-income areas. In 2010, the Obama administration implemented the Healthy Food Financing program, which is a set of initia- tives designed to help bring grocery stores into areas currently designated as food deserts. While this federal program is a commendable effort to improve low-income residents' access to healthy food, local initiatives often have a stron- ger and more immediate impact . Community gardens, independent food stores, co-ops, and farmers' markets are all examples of local initia- tives that can substitute for or supplement the opening of a major chain supermarket. Despite the time, dedication, and funds required for com. munity members to initiate such programs, these efforts can be incredibly beneficial, not only in providing people with access to healthier foods but also in instilling a sense of community in the residents of these neighborhoods.






1. which of the following would be the best title for this passage?

A. supermarkets contributions to obesity in America

B. the dangers of fast food

C. food deserts:the problem and the solutions

D. Food deserts and rural America

E. inconvenience stores: why processed food will kill you ​

Answers

C. food deserts:the problem and the solutions

Which sentence uses the word entourage correctly?

Answers

Answer:

Garret invited his entire entourage to the party, and they all crowded into his tiny apartment.

Explanation:

Entourage means a group of people attending or surrounding an important person.

Which sentence uses the word envisioned correctly?​

Answers

The first sentence is correct

Which line uses alliteration?

O Line 2

O Line 3

O Line 4

O Line 5

Answers

Answer:

line4

Explanation:

because line 3 and line 2 and line 5 are

Answer:

Line 5

Explanation:

Read this sentence from the article.

The cherry trees of Potomac Park and the Tidal Basin are now abloom with their billowy clouds of pale and pink blossoms, rivaled only by those in the land of the Mikado.

What is the tone of the sentence?


formal and objective

informal and objective

formal and subjective

informal and subjective

Answers

Answer:

formal and subjective

Explanation:

i think so

Which literary devices constitute the essential qualities found in every piece of fiction?
A: Literary elements and literary techniques
B: Literary elements
C: Literary devices
D: All of the above

Answers

Answer:

All of the above is the answer in my opinion

2. Change the following sentences into passive.
C a. Hari bought a pen.
b. The boy has written a poem.
c. National park attract tourist.
d. Children like sweets.
e. Anil is making a chair.

Answers

a. A pen was bought by Hari.
b. A poem has been written by the boy.
c. Tourist were attracted by the national park.
d. Sweets are liked by children.
e. A chair is made being made by Anil.

Explanation:
In active voice: doer is suppose to be in the front of the sentence and receiver is suppose to be at the back of the sentence.

In passive voice: does is suppose to be at the back of the sentence and receiver is suppose to be at the front of the sentence.

Which sentence is an example of formal language?

Answers

Explanation:

the answer is d

I sure hope help

write a letter to your parents telling them four things that makes you happy in your school​

Answers

Answer:

like fr there is nothing that makes me happy in school : ) sorry...................

NO LINKS OR ELSE YOU'LL BE REPORTED! Only answer if you're very good at English.

What is something that the reader and Dante both know, but his friends do not?

A: Dante has a band competition next weekend.

B: Dante plans to finish the leftover pizza with Emilia.

C: Dante has to go home to babysit his little sister.​

Answers

Answer:

C i'm guessing.

Sorry if i'm wrong

Explanation:

Answer:

C: Dante has to go home to babysit his little sister.​

Explanation:

yes

Other Questions
Consider an event you are familiar with, such as a baseball game, a rock concert, or delivering delivering product to a customer. Map out the logistics tasks needed and their sequence in organizing this particular event. Pls someone help me these's problem's! Can yall help me?! :) An unstretched ideal spring hangs vertically from a fixed support. A 0.4 kg object is then attached to the lower end of the spring. The object is pulled down to a distance of 0.35 m below the unstretched position and released from rest at time t= 0. A graph of the subsequent vertical position y of the lower end of the spring as a function of t is given above, where y= 0 when the spring was initially unstretched. At which time is the upward velocity of the object the greatest? Out of the people who have already taken their seats at a seminar, 2 people have black hair while 2 people do not. Considering this data, how many of the next 16 people to take their seats should you expect to be black-haired? Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7