An instrument is gradually lowered beneath the surface of the ocean to measure the temperature and salinity of the water. The graphs below show the change in temperature at each depth in kilometers below the surface.

Image of two graphs. The left graph has the x axis labeled temperature degree C ranging from 0 to 10. The y axis is labeled depth below surface, km, ranging from negative 1.8 to 0. The line on graph goes up vertically starting at about 2 degree C on the x axis and negative 1.9 km on the y axis. The vertical line goes up staying at about 2 degree C and climbs from negative 1.9 km to about negative 0.8 km. The line starts to shift right at negative 0.6 km. The line shifts to the right from 2 degree C to 5 degree C. The line shifts to right more starting at negative 0.5 km and reaches 10 degree C around negative 0.2 km. The line continues up vertically after negative 0.2 km. The right graph has the x axis labeled salinity ranging from 33.8 to 34.6. The y axis is labeled depth below surface, km, ranging from negative 1.8 to 0. The line on the graph starts at 34 on the x axis and 0 km on the y axis. The line starts to shift to the right at negative 0.1 km and levels out at 34.2 on the x axis. At negative 0.2 km the line shifts to the left and continues to shift left until it reaches negative 0.5 km. The line starts to shift to the right again at negative 0.6 and continues to shift right until it reaches negative 1.9 km on the y axis and 34.6 on the x axis.

What is the most valid conclusion regarding ocean depth temperature, based on the data?

A.) The temperature and salinity increase with increasing depth.

B.) The salinity increases as the depth goes closer to zero.

C.) The bottom of the ocean is frozen and salinity levels are low.

D.) The ocean temperature never rises above 10°C and salinity remains constant.

An Instrument Is Gradually Lowered Beneath The Surface Of The Ocean To Measure The Temperature And Salinity

Answers

Answer 1

Answer:

B

Explanation:

Answer 2

The most valid conclusion regarding ocean depth temperature, based on the data, is the salinity increases as the depth goes closer to zero. The correct option is B.

What is an ocean?

An ocean is a large body of salt water. The oceans are divided into seven kinds. But they are interconnected to each other. The ocean is the largest water body, and it is also present in the form of freeze blocks of ice.

The graph is given of the temperature and salinity of the ocean, with the depth of the ocean the temperature of the ocean decreases, and the salinity increases.

The salinity of the water represents the presence of salt in the oceans. It. the graph proves that the salinity increases with the depth, coming closer to the depth.

Thus, the correct option is B.) The salinity increases as the depth goes closer to zero.

To learn more about the ocean, refer to the link:

https://brainly.com/question/26063815

#SPJ5


Related Questions

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

14. The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answers

Question:-

The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answer:-

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits.

Explanation:-

The active site is one such gap or pocket to which the substrate adapts and binds to the enzyme.

The active site is the region of the enzyme to which the substrate molecule binds and causes a chemical reaction. The active site is composed of amino acid residues that form a temporary bond with the substrate.

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Answers

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

https://brainly.com/question/5186929

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

A biological factor that is correlated with borderline personality disorder is:
a)
a high level of testosterone.
b)
a low level of serotonin.
c)
a high level of serotonin.
d)
a low level of testosterone.

Answers

A low level of testosterone

Help help bell help help

Answers

6 units
because it is decreasing by three every time

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

Which of the following correctly describes a graded potential?

Answers

Answer:

Graded potentials are changes in membrane potential that vary in size, as opposed to being all-or-none.

Explanation:

btw, where are the options?

The statement which correctly describes a graded potential is: amplitude of various sizes.

Graded potential refers to a temporary change in electric or membrane potential of a stimulus with respect to both its size and distance.

Amplitude can be defined as the maximum displacement of a wave when measured from its equilibrium position.

Thus, amplitude is measured vertically from an equilibrium position.

Generally, a graded potential is directly proportional in amplitude to the size of the stimulus that is send as an input due to the following:

DepolarizationHyperpolarization

In conclusion, the statement which correctly describes a graded potential is amplitude of various sizes.

Read more on graded potential here: https://brainly.com/question/25377211

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

why are the offspring of coral identical to the parent

they reproduce sexually so offspring have increased genetic variation

they reproduce asexually so offspring have increased genetic variation

they reproduce sexually so offspring have decreased genetic variation

they reproduce asexually so offspring have decreased genetic variation

Answers

Answer:

they reproduce asexually so offspring have decreased genetic variation

Explanation:

when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!

Scientists can determine the exact age of a fossil by how much carbon is left in the fossil. This is called

Question 9 options:

Both of these


None of these


Relative dating


Radiometric dating

Answers

Scientists can determine the exact age of a fossil by a technique called  Radiometric dating. Radiocarbon dating involves the determination of how much carbon is left in the fossil.

In radiocarbon dating, it is possible to determine how much carbon is left in the fossil, by looking at its half-life period.

Radiocarbon dating (also known as carbon dating) refers to the technique aimed at determining the age of a fossil by exploring the properties of a radioactive carbon isotope called radiocarbon.

Radiocarbon or carbon-14 (14C) is a radioactive carbon isotope of carbon that contains 6 protons and 8 neutrons, whose amount in a sample can de be used to determine the age of a given organic material.

Learn more about radiocarbon here:

https://brainly.com/question/12693872

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

Distinguish between dimorphic, polymorphic, and continuously variable traits.

Answers

Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:

Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.

When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.

Continuously variable traits are those that show a continuous distribution of phenotypes.

Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.

Learn more about polymorphic traits here: https://brainly.com/question/7882029

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

Answers

Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).

Explanation:

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

Answers

Answer:

FM radios and TV remote controls.

All of the following would result in a population increase except

- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate

Answers

Answer: B

Explanation: because birth and immigration is making the group bigger zero deaths and animals leaving
Hope this helps.

The answer I would choose is a low birth rate.

pls help click the link answer​

Answers

Answer:

1. Transfer

2. Share

3. Subscript

4. Positive

Other Questions
Solve six and two-sixths times one and one half. six and two twelfths eight and six twelfths nine and six twelfths ten and two twelfths Which statement best summarizes the central idea of this passage? in america, great things can be achieved if one plans in advance and works hard. Political struggles are not the only things that create a latino or latina identity. There are many different aspects to a latino identity, including the importance of family. Identity comes from many aspects, including political struggles that inspire how one lives life. Please help peeps Thanks the merchant of venice what was the consequence of the wrong casket Is the system of equations consistent and independent, consistent and dependent, or inconsistent? y=4x4y=4x 4 Select the correct answer from the drop-down menu. *will give brainliest IF YOU GET IT RIGHT* According the mercantilist theories what relationship is correct?The colonies were to provide manufactured goods to the mother country.The colonies were to provide materials, markets and manufactured goods for the mother country.The colonies were to provide markets for the raw materials of the mother country.The colonies were to provide markets for the mother country. PLS HELP ASAP ILL GIVE BRAINLKEST THANKS Find the value of x. which statement describes how the binary ionic compound cacl2 is named? explain how the information in this diagram indicates that an oxygen atom could bond covalently to two hydrogen atoms to form water Pleaseeeee HELPPPP THIS IS TIMED ALSO,A book slides along a table and comes to a stop. Explain, in detail, all the forces acting on the book. what does it mean workmanship???? Answer the questions with full sentences.What's your name?Where are you from?How old are you?What do you like? The magnetic field 0. 02 m from a wire is 0. 1 T. What is the magnitude of the magnetic field 0. 01 m from the same wire? 0. 01 T 0. 05 T 0. 1 T 0. 2 T. Toya has a car loan of $8500. Over the course of the loan, she paid a total of $5526 in interest at a rate of 13%. How many months was the car loan? plz help i will give branlyist to first right answer when you think carefully and closely about your essay topic, you are engaging in the very important process of _____. What is one way to strengthen social ties with other people?. Which of the following statements about main idea is true?. The ordered pairs (4,3), (2,2), (4,1), (6,2), and (8,3) represent a function. What is a rule that represents this function?Write an inequality for the following statement:The difference between twice a number and 6 is at least 35. 62n352n6352n63562n