And insurance agent receives 15% of the cost of each insurance policy she sells how much does the agent receive for a policy thst cost $300

Answers

Answer 1

In this question there are several important information's provided. Using these information's it is easy to get the answer to the question asked. Firstly it is already informed that the insurance agent gets a commission of 15% of the policy price for every policy sold. The agent sells a policy of $300.

Now we can write the equation as:

15% of $300 = [(15/100) * 300] dollars

                    = ( 15 * 3) dollars

                    = 45 dollars

So the agent gets a commission of $45 for selling a policy worth $300


Related Questions

What is the slope and y intercept of Y= -4x + 2

Answers

Answer:

Slope=-4

Y intercept= 0,2

Step-by-step explanation:

Use the slope-intercept form to find the slope and y-intercept.

Evaluate the expression 3.5* when x is 2.

Answers

Answer:

It is 7

Step-by-step explanation:

3.5 times two is seven

PLSSS HELP MEEEEEEEEE

Answers

Answer:

Ryan's raft

Step-by-step explanation:

Ryan's raft has greater rate of change

Which of the following would be in the solution set to the system of inequalities given below?

(-4,0)
Both (-4,0) and (0,2)
No solution
(0,2)

Answers

Answer:

(-4,0)

Step-by-step explanation:

plzz follow me

(-4,0) is the solution of the set to the system of inequalities

What is Inequality?

a relationship between two expressions or values that are not equal to each other is called 'inequality.

The given two inequalities are

y<-3x-6 and 4x-2y<-8

Let us check for (-4, 0)

0<-3(-4)-6

0<6

4x-2y<-8

4(-4)-2(0)<-8

-16<-8

So (-4, 0) is the solution of the inequalities.

Now let us check for (0, 2)

replace y value as 2 and x as 0.

2<-3(0)-6

2<-6

Which is not true.

Hence, (-4,0) is the solution of the set to the system of inequalities.

To learn more on Inequality click:

https://brainly.com/question/28823603

#SPJ2

Explain ASAP PLEASE!!!!!!

Answers

Answer:

C

Step-by-step explanation:

you can make a right triangle from the center of one base to the edge of that circle, and then up to a point on the circumference of the other base

the bases of the triangle would be 2 and 5

so that gives sqrrt 29

Melissa just finished a new book about a time-traveling magician. She read the same amount every day and completed the book in just 10 days! The book had 85 pages.
How many pages did Melissa read each day?
Write your answer as a proper fraction or mixed number.

Answers

Answer:

8 1/2

Step-by-step explanation:

She read 8 1/2 pages each day because if you divide 85 by 10 you will get 8 1/2.

Can someone help me! Please

Answers

Answer:

4c - 2

Step-by-step explanation:

Add up all the terms to find the perimeter.

2c + 2(c - 1)

2c + 2c - 2

4c - 2

Therefore, the perimeter is 4c - 2.

Seven less than three times a number is 14. Find the number.

Answers

Answer:

Steps:

Use the equation 3x-7=14 to find the missing number.

Add 7 to both sides.

3x=21

Divide both sides to isolate x

x=7

Therefore, the correct answer is 7.

You can check by multiplying 7 by three and then subtracting 7 from it and get 14.

Express the recurring decimal 0.56 as a fraction in its simplest form.


Answers

Answer:

0,13

Step-by-step explanation:

the answer of the question is 14/25

Which expression uses the associative property to make it easier to evaluate 14(1/7x2/5)?
A. (14x1/7)2/5
B.7(1/14x2/5)
C.(14x5/2)1/7.
D.14(2/5x1/7)​

Answers

Answer:

A

Step-by-step explanation:

Associative property:

(a+b)+c=a+(b+c)

(a*b)*c=a*(b*c)

help me guys show your solution and answer the qquestion

Answers

Step-by-step explanation:

Line2

x - y = 3/2x = y + 3/2

Line 3

3x + 2y = 63x = -2y + 6x = -2/3y + 2

Line 4

1/4x + y = 2y = -1/4x + 2

Line 5

4x - 3y = -333y = 4x + 33y = 4/3x + 11

Questions

1. Yes. You need to isolate the variable to find and simplify.2. To solve for x would require to multiply all terms by 4 to get rid of fraction3. It wouldn't be easy because of the fraction. To make it easier would use multiples of 3 for x.

Can someone help me please

Answers

Answer:

I'm gonna go with D

Step-by-step explanation:

If it's wrong meh bad

Step-by-step explanation:

From this figure I think the answer is c

May you please help me with this question!

Answers

Answer:

9/4x to the power of one plus 12y to the power of one

Step-by-step explanation:

You can add the top numbers for 9, but cant add the bottoms since they are different variables.

Answer:

[tex]\frac{6y+7x}{12xy}[/tex]

Step-by-step explanation:

i hope this helps :)

Brian goes to schol 6 hours per day, works 4 hours perday, and sleeps for 9 hours per day. What is the ratio of hours Brian works to hours Brian sleeps?

Answers

6:4:9 is the answer

The ratio of hours Brian works to hours Brian sleeps is 4/9.

What is ratio?

A ratio is a comparison between two amounts that is calculated by dividing one amount by the other. The quotient a/b is referred to as the ratio between a and b if a and b are two values of the same kind and with the same units, such that b is not equal to 0. Ratios are represented by the colon symbol (:). As a result, the ratio a/b has no units and is represented by the notation a: b.

Given:

Brian goes to school 6 hours per day, works 4 hours per day, and sleeps for 9 hours per day.

So, the ratio of hours Brian works to hours Brian sleeps

= 4/ 9

Hence, the ratio is 4/9.

Learn more about ratio here:

https://brainly.com/question/13419413

#SPJ5

can somebody please answer this ? Will mark brainliest if you hurry

Answers

Answer:

83 calories

Step-by-step explanation:

Answer:

553 calories

Step-by-step explanation:

He will burn 420 for running because 1,080/2.5 = 420. He will burn 133 because 266 times 0.5 equals 133. So a total of 553 when you add the two.

Please help-

I will try and give a lot of points

Answers

Answer:

25%, since 1/4=0.25 and 0.25*100 is 25%

Hope it helps!

Answer:

Step-by-step explanation:

Given data:

The given fraction is [tex]\frac{1}{4}[/tex]

The given fraction can be written as,

[tex]\frac{1}{4}=0.25\\=\frac{25}{100} \\=25 percentage[/tex]

Thus , the given fraction is 25%.

PLEASE MARK ME AS BRAINLIEST

True or False: A FICO score is named after its creator, Fair Isaac, and Corporation. It
summarizes the probability that a person with debt will repay that debt.

Answers

Answer:

true

Step-by-step explanation:

Please tell me how to simplify this

Answers

What the top person said

What's at stake?

Forests are cradles of life—around four-fifths of all land species live in tropical forests. They play a vital role in regulating our climate by absorbing carbon dioxide, and help maintain our soil and water.

Forests directly support around 1.6 billion people—nearly a quarter of the world's population. And we all rely on them for the air we breathe and the countless products they provide.

But over the last half-century, people have destroyed forests at an alarming rate. We've already lost around half of the world's original forests.


The story so far

In the early 1990s, we campaigned to stop the timber industry destroying and degrading the world's forests.

At the time, few businesses believed they were responsible for where their timber came from. Those that did claim to sell products from well-managed forests had no way of proving it.

"Businesses didn't think the environment was their concern," recalls Jean-Paul Jeanrenaud, who led WWF-UK's work on forests at the time.

"We had chief executives slamming the phone down on us. I even had people threaten to punch me."

How things have changed… In September 1991, British DIY chain B&Q committed to working with us to buy only legal, sustainable timber. By the end of that year, 16 large UK companies had committed to sourcing their timber products from well-managed forests.

That was the beginning of our Global Forest & Trade Network. Today, it's a global partnership of some 275 retailers, producers, community groups and other organizations from across the forest industry supply chain. Members are committed to safeguarding the world's forests and the communities, economies and ecosystems that depend on them.

But we needed a way to turn those commitments into reality. So in 1993, we helped form the Forest Stewardship Council (FSC) to certify timber and wood-based products that meet high environmental and social standards.

For a forest to be FSC certified, independent inspectors check that it meets the FSC's strict criteria. All trees that are cut down have to be replaced or allowed to re-grow naturally, and parts of the forest are left untouched. The rights of indigenous people are respected, and local workers are employed on a decent salary. Often, companies support other social services, such as schools and clinics.

Inspectors also check every stage along the supply chain, so you can be sure that any product that bears the FSC logo is good for forests, people and wildlife.


Did you know?

Just 10 years ago, only 300 sq km of forest in Russia was FSC-certified. Today, it's 260,000 sq km—a quarter of its commercial forests.


Facts and stats

1.4 million sq km—area of forest certified by the FSC. That's an area more than twice the size of France
81—number of countries with FSC-certified forests
40 percent—forest area of Europe and North America certified by the FSC
US$73bn—annual sales of forest-based products by members of our Global Forest & Trade Network

What next?

Almost a tenth of forest products traded now meet FSC standards. That's a phenomenal rate of growth—but it means nine-tenths of products are still uncertified.

We believe some areas of forest need to be protected from any commercial logging. But we're supporting responsible forestry alongside protected areas to help conserve the world's most important forests:

In the Congo Basin, the largest area of tropical forest after the Amazon, 45,000 sq km is now FSC certified—and we're working with everyone from heads of state on down to increase this. As well as protecting important habitats for elephants, great apes and many other species, sustainable forestry is improving livelihoods for some of the poorest people on the planet.
In Borneo, we're working to conserve and restore the "Heart of Borneo," a 220,000 sq km area of the island's species-rich rainforest. Responsible forestry is a vital aspect of this: some 20,000 sq km is already FSC certified or in the process of certification. By 2020, we want the entire Heart of Borneo area to be protected or managed sustainably.
In the western Mediterranean, people have sustainably harvested cork for centuries. Cork oak forests provide a haven for rare plants, birds and other wildlife, including the Iberian lynx, the world's most endangered wild cat. We're promoting FSC certification to keep sustainable cork harvesting economically viable and help protect this unique landscape.

What you can do

You can help secure a future for the world's forests, and the people and animals that depend upon them next time you buy a table—or any other wood-based product.

Only buy products with the FSC label—it's the only credible certification scheme.

If you don't see the logo, ask the store or manufacturer why not. Make sure they realize that you as a customer want to know that the products you buy don't destroy forests. This message will swiftly get back to their suppliers.

Answers

Answer:

a type of meat that you can eat

Car survey
In a survey of 2400 people who owned a current type of car, 1440 said they would buy that type of car again.....

Answers

Answer: 60%

Step-by-step explanation:

1440/2400

Divide both numbers by 480

The quotient is now:

3/5

To find the percentage of a fraction of people, you have to multiply the fraction by 100%

3/5 x 100% = 300/5

300/5 = 60%

Answer:

its 20

Step-by-step explanation:

Can I get some help thank u sm

Answers

Answer:

11

Step-by-step explanation:

The sum of interior angles is equal to exterior angle

Given the following

Interior angles = 5x + 10 and 58

Exterior angle 11x+2

According to the postulate:

5x + 10 + 58 = 11x + 2

5x + 68 = 11x + 2

Collect like terms

5x -11x = 2 - 68

-6x = -66

x = -66/-6

x = 11

The value of x is 11

Leah spent three times the amount Damean spent on CDs. Damean spent $33.87. How much did Leah spend on CDs?​

Answers

Answer:

$101.61

Step-by-step explanation:

33.87 times 3 = 101.61

Answer:

She spent $101. 61 on CD's

Step-by-step explanation:

You need to multiply 33.87 by three since she spent three times as much.

2.) A car rental company is charging a
$50 rental fee and then $0.17 per mile.
.
Write an expression that represents the
total cost of renting a car for a day using
m for number of miles.
If Kane traveled 55 miles, how much
did his trip cost?

Answers

Answer:

y=0.17x+50.   His trip cost $50.85

Step-by-step explanation:

The boys wrestling team scored a total of 36 points. Pins are worth 6 points. Major
decisions are worth 4 points. Write an equation to represent this situation.

Answers

Answer:

6p + 4d = 36

Step-by-step explanation:

If p = number of pins and d = number of major decisions, then the equation is 6p + 4d = 36.

Hope this helps!

Solve for x and find AB
Solve for y and find BX

Answers

9514 1404 393

Answer:

x = 7; AB = 30y = 5; BX = 25

Step-by-step explanation:

Opposite sides of a parallelogram are the same length.

  AB = CD

  5x -5 = 3x +9

  2x = 14

  x = 7

  AB = 5(7) -5)

  AB = 30

__

The diagonals of a parallelogram are bisected by each other.

  XB = XD

  7y -10 = 5y

  2y = 10

  y = 5

  BX = 7(5) -10

  BX = 25

Write a rule for the translation of AABC to AA'B'C'

Answers

Answer:

(x-1,y-2)

Step-by-step explanation:

117 is 0.9% of what number. Would you expect the answer to be a lot less than 117, slightly less than 117, slightly greater than 117, or a lot greater than 117?

Answers

Answer:

13,000. A lot greater as its 99.1% more.

Step-by-step explanation:

calculator shall guide you.

Brainliest to right answer

Answers

Answer:

(-8) is the missing value here, so

the coordinates will be (-8,8)

Answer:

-8

Step-by-step explanation:

→ Substitute y = 8 into -4x - y = 24

-4x - 8 = 24

→ Add 8 to both sides to isolate -4x

-4x = 32

→ Divide both sides by -4 to isolate x

x = -8

Suzie solves the equation below:
x2 + 4x - 12 = 2
(x - 2)(x + 6) = 2,
by setting x -2 = 0 and x + 6 = 0.
Her solutions are x = 2 and x = -6.
Is Suzie correct? Why or why not?

Answers

Answer:

Suzie's answers are incorrect.

Step-by-step explanation:

x^2+4x-12=2

           +12  +12

x^2+4x=14

(if we put Suzie's answer in for x)-

2^2+4(2)=14

4+8=14

Suzie's first answer is incorrect (4+8=12)

Let's try the next one with Suzie's answer

(-6-2)(-6+6)=2

(-8)(0)=2

This answer is also incorrect. (-8*0=0)

Someone help plz!!! I need some help!

Answers

Answer: -24

Explanation:

f(-9) = 3(-9) + 3

f(-9) = -27 + 3

f(9) = -24

Other Questions
Which rule applies to the translation of the RED trapezoid to the BLUE trapezoid?)(c.y) - (x* 2, y- 3)B)(x. y) - (x+ 4, y- 5)(x, y) - (x + 2, y - 5)D)(.Y) - (x- 2, y - 5) what color is the darkest.A. RedB. BlueC. purpleD. Black Read this excerpt from from Robinson Crusoe:Then I took my turn, and embraced him as my deliverer,and we rejoiced together. I told him I looked upon him as aman sent from Heaven to deliver me, and that the wholetransaction seemed to be a chain of wonders (243).Based on the wording in this excerpt, which of the following is Crusoe mostlikely describing?O A. A mutineerOB. A cannibalOC. The captainOD. Friday the measure of G is 82. What is the measure of its compliment? facts on wourld war 2 TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA HELP! SSUUUUUUUUPER EASY! REEEEEEEEEEEALLY QUICK! I'm just du. mb Below is an equilateral triangle. Find the value of x, then find the value of a side length. How do we use positive and negative signs to communicate the direction of a vector Fill in the question mark area of the dimensional analysis set up with the correct conversion 3.25 x 10-3 molecules H2O x 1 mole moles PLEASSSS HELPPPP How do you feel about the way you spend money on needs and wants? Is there anything you'd like to change about your spending habits when it comes to needs versus wants? A party rental company has chairs and tables for rent. The total cost to rent 4 chairs and 8 tables is 89 . The total cost to rent 2 chairs and 3 tables is 34 . What is the cost to rent each chair and each table? PLEASE HELP WILL GIVE 10pts AND BRAINLIEST FOR THE RIGHT ANWSER!!!Jackson just started kindergarten and his teacher has noticed that he if having trouble identifying objects with their correct names and seems to have reduced complexity of vocabulary and sentence structure types. Based on this, what does Jackson's teacher suspect that he might be dealing with? A) emotional delayB) physical delayC) cognitive delayD) speech delay In 35 words or fewer, why do you think it's important to learn about thepurpose, context, and audience of a rhetorical work like a speech? what type of speech would the sentence The Kid Was A Young Albert Einstein Find the values of the variables in the parallelogram. Change these times to the 24-hour clock.c)8:15 pmd)midnight Los estudiantes ______ las preguntas.contestancontestamoscontestiscontesta (pls) Find the slope of the line through (9, 4) and (0, 5). Patty is baking for the holidays. 3/5of her treats are cookies and 1/6of her treats are cupcakes. The rest are brownies. What fraction of her treats are brownies?