AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.

Answers

Answer 1

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

Answer 2

Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.

1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.

In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.

2. In the given set, the possible amino acid sequences can be given as:

Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.

In the given sequence:

Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid

The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.

To know more about codons, refer to the following link:

https://brainly.com/question/19153211


Related Questions

All living things respond to external stimuli. Explain.​

Answers

..

Explanation:

your lucky you did have a online lessons early

Answer:

All living things respond to external stimuli .

Explain All living beings respond to stimuli because they all have some or other form of control and coordination system in their bodies. This system which may be nervous system or a hormonal system which is responsible for responding to the stimuli.

Explanation:

I hope it helps ❤

In the testes, sperm cells replicate and differentiate in the _________. Question 2 options: urethra septum tunica albuginea seminiferous tubules ductus deferens

Answers

Answer:

seminiferous tubules

Explanation:

Seminiferous tubules are coiled tubes where sperm cells are produced by a process referred to as spermatogenesis. These tubes are located in the testes or testicles (i.e., male reproductive glands/gonads). Each testicle contains approximately 250 compartments known as testicular lobules, while each testicular lobule has 1 to 4 seminiferous tubules which converge to form a single straight tubule. Once sperm cells mature, they travel through the seminiferous tubules to be stored in a coiled tube called the epididymis.

What are the components of blood ​

Answers

Explanation:

Blood is a specialized body fluid. It has four main components:

plasma, red blood cells, white blood cells, and platelets.

Blood has many different functions, including: transporting oxygen and nutrients to the lungs and tissues.


7. What two reactants of photosynthesis are used for the light reactions?
a. Carbon dioxide, water
b. Carbon dioxide, sunlight
C. water, sunlight
d. glucose, sunlight

Answers

Answer:

sunlight, carbon dioxide, water

Explanation:

If the sodium/potassium ion pump were to stop functioning, what would eventually happen to the concentration gradients of sodium and potassium ions across the membrane

Answers

Answer:

The correct answer would be - concentration gradient will reach to equilibrium.

Explanation:

If the Na+/K= ion pump stops working which is to pump the sodium and potassium ion across the cell membrane. The movement takes place in 3:2 ratio with the help of ATP.

Eventually, the concentration gradients of sodium and potassium would be equal and found equilibrium across the membrane. This equilibrium would be reached due to passive transport that occurs in either direction across the membrane.

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

i need some help here now ASAP

Answers

Answer:

None of those, its called Soul Horizons

Explanation:

Answer:

Soil Layers also know as Soil Horizons.

Explanation:

Lister cultured the bacteria responsible for milk spoilage.
True
False

Answers

Answer:

True

Explanation:

Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem


WILL GIVE BRAINLIEST

Answers

1 population
2 species
3 economists
4 biome
5 biosphere

name two types of silkworms that are fed on mulberry leaves​

Answers

Bombyx Mori L
It’s only one that I’m very sure of I hope this helps

I need this to finish break out room. Unscramble and enter the escape word hint it is what you do when you eat. Letter are ell ts gi

Answers

A n s w e r:

Digest, maybe

Answer:

u got snap, or ig since u go to my school,and we can help eachother with our work it u want


2. Why do you need to chew the food well?
why do you need to chew the food well ​

Answers

you need to to be able to digest it

Answer:

Because if that's how we get the full benefit from foods. Also, when you chew your food properly, your body releases digestive enzymes in the stomach that help to break down food so that your body can convert it into energy.

Zara had a birthday and was able to choose a pet. The pet that she chose was a beautiful clownfish named Bozo, a common salt water fish. Zara already has a tank with goldfish at home. Use your knowledge of diffusion & osmosis to tell Zara how to take care of Bozo.

Answers

Answer:

See the answer below

Explanation:

The advice I would give  to Zara would be that she should keep Bozo in a separate tank with common salt water away from the goldfish. Bozo is a salt water fish while the goldfish can only survive in freshwater.

If Bozo is kept in a saltless water/freshwater tank with the goldfish, the water would be hypotonic to Bozo. Consequently, water will osmotically diffuse into the cells of Bozo, the cells would become turgid and lyse, and this would lead to the death of the fish.

If the goldfish is kept in the same salt water tank with Bozo, the salt water would be hypertonic to the goldfish. Consequently, water will osmotically diffuse out of the cells of the goldfish into the surrounding salt water, the cells of the goldfish would become flaccid, and this would lead to the death of the fish.

The diagram below represents a top view of a river a emptying into an ocean bay. A - B is a reference line along the bottom of the bay. Which characteristic would most likely decrease along the reference line from A to B? (1) the amount of salt in solution (2) the size of the sedi ments (3) the density of the water (4 ) the depth of the water

Answers

Answer: D

Explanation: it’s the size of the sediments

Why is your body going through physical and chemical changes?

Answers

Answer:

(MY) body is only going through chemical changes because of my digestive juices, my saliva, and brain functions.

Explanation:

{MY} body isn't going through many physical changes other than my body slowly breaking down on a nuclear level every day slowly just like everybody else that's why nobody dies of old age, its just the teardown of their body eventaully giving out

When equipment malfunctions, a(n) _____ needs to be initiated.

A) Notification

B) Paper Work

C) Alarm

D) Work Order

Answers

Answer: Alarm

Explanation:

When equipment malfunctions, an alarm should be initiated to bring the malfunction to the attention of the relevant personnel.

This will ensure that whatever adverse effects the malfunction could have caused is mitigated and the machine can be attended to on time to prevent further damage.

What is the medical term for the process or procedure that destroys or inhibits disease-causing microorganisms to prevent infection:

Answers

Answer: Sterilization.

Explanation:

Sterilization is the process that kills, or deactivates all forms of life so then a product is considered free of viable microorganisms. This process must be designed, validated and carried out to ensure that it is capable of eliminating the microbial load of the product.

Since sterility cannot be demonstrated without causing the complete destruction of the products, sterility is considered when the probability of a product being contaminated is acceptably remote. A critical product is considered sterile when the probability of a microorganism being present in an active or latent form is equal to or less than 1 in 1,000,000 (sterility safety factor 10^-6).

Agents that kill microorganisms are called microbicides or more commonly called "germicides". If the agent kills bacteria, it is called a bactericide. And if it kills fungi, then it is called a fungicide. It is important to consider than after an exposure of the sterilized object to the air or its surroundings, it will have become contaminated again with microorganisms.

Examples of sterilization include physical methods and chemical methods. Physical methods include:

Wet heat (in steam autoclave) Dry heat (in sterilization oven) Radiation (gamma radiatio, electron beam, X-ray, ultraviolet, microwave, white light)

Chemical methods include a variety of chemicals in liquid and vapor form, for example:

Hydrogen peroxideChlorine dioxideOzone gasesEthylene oxidePropylene oxidePeracetic acid

7. Which of these are characteristics of viruses? (Select all that apply.)
not living organisms
are single-celled
are decomposers
cannot reproduce without a host

Answers

Answer:

I believe the answers are not living organisms and cannot reproduce without a host.

Explanation:

Which description represents a medium?
a - energy that moves with a wave
b-midway point through a wave
c- a wave that can travel through a vacuum
d- material through which waves can travel​

Answers

The answer is b
Midway point through a wave

which wall structures are found in plant cells but not in animal cells check all that apply
cell wall
cell membrane
endoplasmic reticulum
nucleus
chloroplasts
mitochondria​

Answers

Answer:

cell wall, chloroplasts

Explanation:

no explanation, just the correct answer

Answer:

Options: A and E

Explanation:It was correct on edg 2021, Have a blessed day.

Which of these are characteristics of all three main groups of worms? Check all that apply.

They lack nerve cells.
They can reproduce sexually.
They display bilateral symmetry.
They have a single tissue layer.
They are invertebrates.
Multiple choice

Answers

They lack nerve cells, They display bilateral symmetry, They are invertebrates. A, C, E

Answer:

they can reproduce sexually

they display bilateral symmetry

they are invertebrates

Explanation:

Genes Influence an organism's tralts by coding for:

Answers

Answer:

production of proteins

Explanation:

Which nitrogen base sequence is the partner of C-A-T-C-G-A?

Answers

g- t- a- g- c - t or if ur trying to find the mRNA things it’s g- u- a- g- c- u

it depends really but i think this is the answer

Answer: G–T–A–G–C–T

Explanation:

What is the relationship between Distance and average number of species?

Answers

Answer: The relationship between species and distance is that more distance or space has more species and less space has less species.

Explanation:

It can easily be understood by taking the example of the island in such a way that the larger islands contains more species than smaller islands.

There are a  diversity of species seen in a bigger islands, more in number and more in variety.

It is very important for the studying the various species and its conservation, protection and other factors.

So, more is the distance , more will be the number of species.

Rejection occurs when the recipient’s immune system recognizes the donor tissue as foreign

Answers

That's because the patient's immune system discovers that the antigens on the cells of the organ are different.

PLEASE ANSWER.

Purple is dominant to white. A flower with the alleles PP (purple) is
crossed with a flower with alleles pp (white). What is the percent chance
that their offspring (babies) will be purple?

0%
50%
100%

Answers

Answer:

100% P is dominate there for all matches will be Pp this mean it will either be purple or a mixture of both (pink)

Explanation:

the chances will be 100% Purple flowers

Comprehension Questions:
Available in 01:28
Photosynthesis and cellular
respiration are
cells.
that ocCur in
))
O chemical reactions
O physical reactions

Answers

Answer:

Chemical reactions

Explanation:

                                                                             

Which two structures are found at the outside of the cell?

Answers

Answer:

All cells share common components: (1) a plasma membrane, an outer covering that separates the cell's interior from its surrounding environment; (2) cytoplasm, consisting of a jelly-like region within the cell in which other cellular components are found; (3) DNA, the genetic material of the cell.

5. What would be the effect if a gene has a mutation in the location of the stop codon? (4 points)

Answers

During translation protein synthesis won't stop when it should so amino acids will continue to be placed and the peptide will be bigger.

Answer:

In genetics, a point-nonsense mutation is a point mutation in a sequence of DNA that results in a premature stop codon, or a point-nonsense codon in the transcribed mRNA, and in a truncated, incomplete, and usually nonfunctional protein product.

CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU

Answers

Answer:

The answer is

A. methane

Other Questions
-1/4d-2/5d=39 Solve for d Please explain I dont understand ITS MATH I NEED HELP fix the sentence Susanna came home from a work. She putted the key in the lock of the apartament door. She opened the door. She clearly heard a voise inside her apartment. Was it the TV? Was it the radio? Was it her neighbor? She not know if she should go in or run away! She couldnt move. She couldnt think. She heard the soft sound of footsteps. She couldnt breathe. The door slowly opened. Mom! What are you doing here Susanna said, when she caught her breath. Hi Honey! Dad and I are cooking dinner for you! plz help What is the opportunity cost of buying a $.75 soda every school day for three years Art is a vivid source of history,Explain this statement Pls pls help I dont have time HELP ASAP. It also detects if its right or wrong. Leo ordered shirts for 12 members of the social work team. He had each person'sname printed on the shirt for an added cost of $3 per shirt. If the total cost of theorder was $96, how much did each shirt cost before the names were printed? Ramona went out with her 3 sisters, they spent $58 plus9% tax on their meal. They also left a 15% tip. If they dividedup the bill evenly, how much did each of them spend? PLS HELP I WILL MARK BRAINLYEST BUT PLS JUST HELP MEEEEEEEEEEEEEEMicrowaves have a higher _____________ than radio waves. Different ______________ of microwaves provide different information to scientists. Most microwaves are used in ___________________________. ?Choose the correct expression with its meaning: Organizing your time effectively-?Choose the correct expression with its meaning: How much time you spend at work and home-?Choose the correct option._________________ women have always been desirable in the world of fashion.?Choose the correct option.The park is so _________. It is impossible to see it all in a weekend.?Choose the correct option.I'm not ___________________ or arrogant, but I do believe in my own ability.?Choose the correct option.A _______________ system is a new model in the urban rail transit system in China.?Choose the correct option.She's very good at coping with . situations. ?Choose the correct option.His speeches are very , and I just want to fall asleep.?Choose the correct option.It's to sit on the plane with nothing to read. ?Choose the correct option.We have a year ahead of us in this economic climate.?Choose the correct option.You're going to Africa? How ! ?Choose the correct option.My schedule is quite ... - I could arrange to meet with you any day next week. ?Choose the correct option.Textbook writing can be an intellectually and financially activity. ?Choose the correct option.It is very .. to know that the project was a success. ?Choose the correct option.Whether or not we go to Spain for our holiday on the cost. ?Choose the correct option.Have you had previous of this type of work.?Choose the correct option.One of the requirements of this position is in two or more European languages. ?Read the question and choose the most appropriate answer.None of them is five-star _________ but two are fairly comfortable.?Read the question and choose the most appropriate answer.It is a lonely lake, situated in extremely wild ____________ at a height of 1153 ft.?Read the question and choose the most appropriate answer. If your Dad is feeling so bad, he needs to see a doctor, not just a ___________.?Read the question and choose the most appropriate answer. One of the requirements of the job is in two or more African languages.?Read the question and choose the most appropriate answer.Staff members were given a _______ for finishing the project on schedule.?Read the question and choose the most appropriate answer.If you want to for the job you should write to the company.?Read the question and choose the most appropriate answer. The owner of a small store buys coats for $55.00 each answer part a and d Please help me Ill give all my coins! Write 8 as a product of primes.Use index notation What were the six legal principles that originated in Rome? How do the two definitions of womens freedom differ from one another? An auditorium has 962 seats. There are 37 rows, each with the same number of seats. How many seats are in each row? Clare subscribes to an online music streaming servicefor a yearly fee of $96. Starting next month, there willbe a 12% increase in the fee.The ad for another music streaming service is shownbelow. Should Clare switch? Explain. Why most foods needs to be digested? Give at least 3 reasons The coolant heat storage system:Select one:A. increases hydrocarbon exhaust emissions,B. uses a condenser.C. preheats the engine when the vehicle is started the next time.D. prevents the engine from overheating on hot days. Expand and simplify: (2x-3)2