bond energy is the greatest for?​. a: Ch4 b: O2 c: N2 d: Cl2

Answers

Answer 1

It's answer is c. N2

The maximum bond energy is of N2 because N2 molecule is formed by 3 covalent bonds and O2 molecule is formed by 2 covalent bonds.

Hope it helps :)


Related Questions

The concentration of CI ion in a sample of H,0 is 15.0 ppm. What mass of CI ion is present in 240.0 mL of H,0, which has a density of 1.00 g/mL?

Answers

Answer:

Mass of solute = 0.0036 g

Explanation:

Given data:

Concentration of Cl⁻ = 15.0 ppm

Volume of water = 240 mL

Mass of Cl⁻ present = ?

Solution:

1 mL = 1 g

240 mL = 240 g

Formula:

ppm = mass of solute / mass of sample ×1,000,000

by putting values,

15.0 ppm = (mass of solute / 240 g) ×1,000,000

Mass of solute = 15.0 ppm ×  240 g / 1,000,000

Mass of solute = 0.0036 g

in which type of bond are electron shared between atoms?
A. ionic
B.covalent
C.metallic​

Answers

The answer is B. Covalent bonds
The Awnser is b i think

A gas is brought to a final pressure of 6.8 atm. after increasing its temperature from 40 K to 280 K. Calculate the original pressure of the gas.

Answers

Answer:

0.97 atm.

Explanation:

From the question given above, the following data were obtained:

Final pressure (P2) = 6.8 atm

Initial temperature (T1) = 40 K

Final temperature (T2) = 280 K

Initial pressure (P1) =?

Thus, we can obtain the initial (original) pressure of the gas as follow:

P1/T1 = P2/T2

P1 /40 = 6.8/280

Cross multiply

P1 × 280 = 40 × 6.8

P1 × 280 = 272

Divide both side by 280

P1 = 272/280

P1 = 0.97 atm

Therefore, the original pressure of the gas is 0.97 atm.

a wooden block with a mass of 2.0kg starts from at the top of an inclined plane and ends with a force of 25N at the bottom what was the rate of acceleration of the block

Answers

Answer:

Force F = 20N .

Mass m = 2.0 kg

Initial velocity u = 0

acceleration, a = 10m/s  

2

 

t = 1 sec.

Now Refer to the attachment, See the free body diagram of the block.

Force works on the block:-

Weight, W = mg

W = 2 × 10

W = 20N (which is Downward)  

Normal force N = mg cos37

N = 20 × 0.80  

N = 16 N. (perpendicular & upward to the plane )

Here Applied Force, P = 20N (which is down along the plane)

Now For Final Speed, We know the formula:-

v = u + at

v = 0 + 10 × 1

v = 10 m/s

the Distance travelled s = ut + 0.5 at×t

s = 0 + 0.5 ×10×1×1

s = 5 m.

Now,

(a)     So work done by the force of gravity in 1 sec. = F × d

             ⇒20 N × 5m      

             ⇒100 J.

(b) Here the weight act as downward, so distance travelled in downward.

             ⇒5 × sin37

             ⇒5 × 0.6  

             ⇒3 m.

 

so work done by gravity,

               ⇒20 N × 3 m

              ⇒60 J.

(c) Now, work done by all the forces  

               ⇒change in Kinetic energy

  ⇒

2

1  m(v2

−u  2

)

⇒0.5×2.0×(10  2

−0  2  )

⇒ 100 J.

⇒W.D by frictional force  

                 = work was done by all forces -( work was done by Normal force + work done by applied force + work done by gravity )  

                 = 100 J - (100 + 60 +0 )

                 = 100 - 1

     Hope this helps you≅        

           

What kind of reactions tend to be spontaneous?
O A. Reactions that are endothermic
B. Reactions that are exothermic
C. Reactions that decrease in entropy
D. Reactions that increase in enthalpy

Answers

The spontaneous reactions are said to be exothermic in nature. Hence, option B is correct.

What is a spontaneous reaction?

The type of reaction that has not been utilizing energy input output to the reaction system in order to favor the formation of product are termed as exothermic reaction.

The entropy has been the tendency of the randomness of atoms in the system, and the enthalpy has been the energy of the system.

With the spontaneous reaction, there has been an increase in the entropy of the system with the formation of the products, and a decrease in the enthalpy. The reaction forms no use of the input energy, and thereby cannot be endothermic in nature.

Therefore, the reaction that is exothermic tends to be spontaneous reactions. Hence, option B is correct.

Learn more about the spontaneous reaction here:

https://brainly.com/question/23142328

#SPJ5

Does iron always have a charge of 2+ when it forms an ion

Answers

Answer:

Roman numeral notation indicates charge of ion when element commonly forms more than one ion. For example, iron(II) has a 2+ charge; iron(III) a 3+ charge.

Explanation:

How many atoms are in a sample containing 4.000 moles of carbon?
A)6.022 x 10
23
atoms
B)2.408 x 10
24
atoms
O
24
C)7.233 x 10 atoms
D)2.893 x 10
25
atoms

Answers

Answer:

c I think but that's only what i think

Mole measure the number of elementary entities of a given substance that are present in a given sample. Therefore, 24.088×10²³ atoms of carbon are in sample containing 4.000 moles of carbon. The correct option is option B.

What is mole?

The SI unit of amount of substance in chemistry is mole. The mole is used to measure the quantity or amount of substance. We know one mole of any element contains 6.022×10²³ atoms which is also called Avogadro number.

Mathematically,

number of atoms/molecules/ formula units of carbon= number of moles of carbon × 6.022×10²³

number of moles of carbon= 4 moles

substituting all the given values in the above equation, we get

number of atoms/molecules/ formula units of carbon= 4 × 6.022×10²³

number of atoms/molecules/ formula units of carbon=2.4088×10²⁴ atoms of carbon

There are 2.4088×10²⁴ atoms of carbon

Therefore, 24.088×10²³ atoms of carbon are in sample containing 4.000 moles of carbon. The correct option is option B.

To know more about mole, here:

https://brainly.com/question/15209553

#SPJ6

Which chemical equation below is not balanced?
- 3 MgSO4 + 2 Nag PO4 → Mgs (PO4),+3 Na, S04
- 2 NaOH + HNO, → NaNO, + 2 H,0
- CH12 O6 4 6O2 → 6 CO, + 6 H,0
- HBr AGNO, → HNO, + AgBr

pic if needed ;)

Answers

Answer:

B

Explanation:

The second one is not balanced correctly.

2 NaOH + 2HNO3 → 2NaNO3 + 2 H20

I didn't notice this before but it can be balanced without the twos.

 NaOH + HNO3 → NaNO3 +  H20

It was still wrong. It needed to have the twos removed, not 2 more added. Adding two more isn't wrong, but it should be balanced without 2s if at all possible.

Which process is constructive?

A:Water wears away rocks in a river.

B:Wind removes sand from a beach.

C:volcano forms an island in the ocean.

D:An earthquake breaks apart a cliff on a mountain.

Answers

C.
It is the only thing that is making a new thing, and not breaking or taking apart something that is already there.

what is a common use for electromagnets

Answers

Answer:

Electromagnets are widely used as components of other electrical devices, such as motors, generators, electromechanical solenoids, relays, loudspeakers, hard disks, MRI machines, scientific instruments, and magnetic separation equipment.

Explanation:

Hope this helps :)

(didn't get this from the internet)

Giselle is working with a chemical substance in a laboratory. She observes that when the chemical is heated, it gives off a gas. She assumes that the gas is oxygen but decides to test this assumption to verify it. Which type of scientific knowledge is Giselle’s assumption? A. fact B. hypothesis C. law D. observation E. theory

Answers

Answer:

The correct answer is B. Hypothesis

Explanation:

5 A snowball sits at the top of the hill. Which of the following changes will increase the kinetic energy of the snowball? A Additional snow falls on the snowball, increasing its mass. B The snowball is pushed and rolls down the hill, gaining speed. The weather warms and the snowball melts, decreasing its mass. D The snowball is moved and now sits on a hill that is higher.​

Answers

Answer:

B

Explanation:

it is B because in order to have kinetic energy the object has to be in motion, because if it wasnt in motion and sitting on the hill then it has potentail energy, hope this helps

What are the rules for writing
names/formulas for ionic
compounds? Give examples
where you need to produce
the formula from the name
AND the name from the
formula. Make sure to
include examples of
transition metals and
polyatomic ions.

Answers

The rules of writing name is that they start with a big letter LIKE this and ends like this

What is the hardest mineral to burn in the world?

Answers

Answer:

Diamond

Explanation:

dipole dipole bonds are covalent bond?​

Answers

Answer:

The polar covalent bond is much stronger in strength than the dipole-dipole interaction. The former is termed an intramolecular attraction while the latter is termed an intermolecular attraction. So now we can define the two forces: Intramolecular forces are the forces that hold atoms together within a molecule.

Explanation:

I have some things to point out:

#1: There is no such thing as "Dipole-dipole bonds", only Dipole-dipole interactions between molecules that share an unequal balance of electrons between their atoms.

#2: Intermolecular forces of attraction such as Dipole-dipole interactions are not considered as covalent bonds. Covalent bonds are rigid and are considered intramolecular forces of attraction (found within the molecule instead of between)

Hope I have helped you! Many thanks.

1s2 3s2 3p6 3s2 3p6 3d6 4s2 what is element ​

Answers

The element with the electron configuration, 1s2 3s2 3p6 3s2 3p6 3d6 4s2, will be iron.

Atomic number and electronic configurations

In the electronic configuration of elements, the number of electrons possessed by the element is shared into the orbitals according to their energy levels.

The electrons are first shared in orbitals in the same energy level before pairing starts.

Also for neutral atoms, the number of electrons is equivalent to the number of protons. The number of protons in itself represents the atomic number of elements.

Thus, considering this electron configuration, 1s2 3s2 3p6 3s2 3p6 3d6 4s2; the total number of electrons in all the orbitals is 26. The element with the atomic number of 26 is iron.

More on electron configurations can be found here: https://brainly.com/question/14283892

#SPJ1

The molar solubility of CaSO4 in water is 0 .67 gram per liter of solution. Calculate the Ksp.

Answers

Answer:

Ksp = 2.4 * 10⁻⁵

Explanation:

The equation for the dissolution and dissociation of CaSO4 in water is given as: CaSO₄ ---> Ca²⁺ + SO₄²⁻

The expression for the Ksp of the dissociation equation above is:

Ksp = [Ca²⁺] [SO₄²⁻]

The molar ratio of the dissociated ions and the solute is 1 : 1, this means that every 1 mole of CaSO₄ that dissolves produces 1 mole of Ca²⁺ and SO₄²⁻ each

The molar solubility of a substance is the number of moles that dissolve per liter of solution.

molar solubility of CaSO₄ = number of moles /liter of solution

number of moles of CaSO₄ = mass/molar mass

molar mass of CaSO₄ = 136 g/mol

number of moles of CaSO₄ = 0.67/136 = 0.0049 moles

molar solubility of CaSO₄ = 0.0049 mol/ 1 L =  4.9 * 10⁻³ moles per liter

therefore, molar solubility of CaSO₄ = 4.9 * 10⁻³

Ksp = (4.9 * 10⁻³) (4.9 * 10⁻³)

Ksp = 2.4 * 10⁻⁵

Answer:

2.4 * 10^-5

Explanation:

Molar solubility of CaSO4  = 0 .67 g/L/136 g/mol = 4.9 * 10^-3 Mol/L

Given that;

CaSO4(s) -------> Ca^2+(aq) + SO4^2-(aq)

Hence, Ksp = [Ca^2+] [SO4^2-]

Where  [Ca^2+] =[SO4^2-]=s

Ksp = s^2

since s = 4.9 * 10^-3 Mol/L

Ksp = (4.9 * 10^-3 Mol/L)^2

Ksp = 2.4 * 10^-5

what is the balanced equation for naphthalene and sulphur?​

Answers

napthalene: C10H8 sulphur: S02

Explanation:

C10H8

Consider the equation:

4Al + 3O2 = 2Al2O3

Is this equation balanced? Why or why not?

Answers

The equation is balanced. There are 4 aluminium atoms and 6 oxygen atoms on each side.

why is it important to prepare for disaster? what are the things you need to prepare?​

Answers

Explanation:

The reason why it is important to prepare for an disaster is because Being prepared can reduce fear, anxiety, and losses that accompany disasters. People also can reduce the impact of disasters (flood proofing, elevating a home or moving a home out of one's harm's way, and securing items that could shake loose in an earthquake) and sometimes avoid the danger completely.

The things you need to prepare for an disaster is

WaterFoodClothing Money if neededFlash lightBatteriesFirst aid kitYou can even need an radio( to keep updated).


Explain how atomic
radius, valence electrons
and effect nuclear charge
creates the trend for metal
reactivity.

Answers

Answer:A higher effective nuclear charge causes greater attractions to the electrons, pulling the electron cloud closer to the nucleus which results in a smaller atomic radius. Down a group, the number of energy levels (n) increases, so there is a greater distance between the nucleus and the outermost orbital.

Answer:

A higher effective nuclear charge causes greater attractions to the electrons, pulling the electron cloud closer to the nucleus which results in a smaller atomic radius. Down a group, the number of energy levels increases, so there is a greater distance between the nucleus and the outermost orbital.Explanation:

An s orbital has how many orientations? Group of answer choices

Answers

Answer:

One orientation

Explanation:

A s orbital is a sphere like shape that surrounds the atomic nucleus that consists of electrons that can be found at the highest or lowest region of the orbital. S orbitals only consist of "one orientation" and is commonly mistaken by the p orbital because the p orbital also consists of electrons that can be found the most.

Hope this helps.

Assume that the total volume of a metal sample is the sum of the volume occupied by the metal ions making up the lattice and the (separate) volume occupied by the conduction electrons. The density and molar mass of the first metal are 911 kg/m3 and 27.7 g/mol, respectively; assume the radius of an ion is 97.3 pm. (a) What percent of the volume of a sample of this metal is occupied by its conduction electrons

Answers

Answer:

92.4%

Explanation:

The volume per cubic meter of sodium preoccupy by the sodium ions is

[tex]V_{Na} = n \times V[/tex]

where;

volume (V) of each Na atom   = [tex]\dfrac{ 4}{3} \pi r^3[/tex]

Radius of each ion = 97.3 pm = 97.3 × 10⁻¹²

no.of atoms in the sample n =  mass of the sample / ( molar mass / NA)

mass of the sample per cubic metre =  911 kg/m³

[tex]V = \bigg [ \dfrac{4}{3} \pi r^3 \bigg ] \bigg [\dfrac{MN_A}{m} \bigg ][/tex]

[tex]V = \bigg [ \dfrac{4}{3} \pi (97.3 \times 10^{-12} )^3 \bigg ] \bigg [\dfrac{ (911 kg/m^3 (m^3))(6.023\times 10^{23})}{27.7 \times10^{-3}\ kg/mol } \bigg ][/tex]

V = 0.07643 m³

The fraction of available conduction electrons are;

= (1 - V)

= 1 - 0.07643

= 0.92357

≅ 92.4%

someone please help me, the picture is shown above !

Answers

The quality of being easily dissolved in liquid.

Hope this help and Happy holidays
I can’t really see the question and answer choices

4. Kendrick drags his bat out to play baseball. which statement best describes the science of what he did?
O Kendrick would use less energy if he dragged the bat faster.


Kendrick did not have to work to move the bat because he dragged it.


Kindrick gave the bat potential energy.


Kindrick gave the bat kinetic energy.

Answers

Explanation:

Kendrick gave the bat potential Energy

At which point is crust neither created nor destroyed?

island chain
mid-ocean ridge
divergent boundary
transform boundary

Answers

Answer:

transform battery

Explanation:

Answer: D. Transform Boundary

Explanation: I did the test.

1. (solution/solvent/solute) Use the correct word in the following sentence:
dissolved in
makes up a
2 What is the difference between a strong electrolyte and a weak electrolyte?
3. The solubility of sodium chlorate in water is 52g/100g H20. If 0.46 moles of sodium
chlorate are dissolved in 60g of water, is this solution
saturated/supersaturated/unsaturated?

Answers

Answer:

1. solute dissolved in solvent makes up a solution.

What is the atomic number of this atom?

6
8
9
16

Answers

The atomic number of this atom : 8

Further explanation

Given

Atomic model (attached)

Required

The atomic number

Solution

To determine the atomic number of an element, we can look at the number of electrons or the number of protons, because

atomic number = number of protons = number of electrons in neutral atoms

While the mass number is the number of neutrons + the number of protons located in the atomic nucleus

The charge of each of these atomic sub particles:

electron: charge -1proton: charge +1neutron: not charged / 0

If we look at this atomic model, there are 8 electrons in the shell, consisting of 2 electrons in the first shell and 6 electrons in the second shell (which can also be called valence electrons)

Whereas in the atomic nucleus there are 8 protons and 10 neutrons

Answer:8

Explanation:

Throughout the reflection, make sure you have a copy of the Student Guide and your data tables. Complete the paragraph by using the drop-down menus.




In this lab, you modeled and observed the three main ways thermal energy is transferred. When thermal energy transfers from a warmer body or place to a cooler body or place, it is referred to as heat.

------ involves the transfer of heat between two bodies that are touching, ------

is the transfer of heat in a liquid or gas, and -----

is the transfer of heat through space.

Answers

Answer:

Conduction, Convection, and Radiation

Explanation:

I got it right on Edge 2021

the The fill in the blanks should be filled with Conduction, Convection, and Radiation

information regarding heat:

Conduction should include the transfer of heat that lies between the two bodies that could be touched. Convection refers to the transfer of gas that could be in the form of gas or liquid. The radiation should be the transfer of heat via space.

learn more about heat here: https://brainly.com/question/994316?referrer=searchResults

Which of the following statements is true about exothermic reactions?

Answers

Answer:

An Exothermic Reaction , gives off more heat, and a little energy to its surroundings.

this can helps us figure out that the answer is , C, More heat is given off into its products.

Explanation:

Other Questions
Newspaper Article #3 Planning and Rough Draft:Directions: Using the prompt below, you will brainstorm and draft your second article for your magazine. Make sure to complete each days tasks on time, so that you dont fall behind. On Friday, you will be creating your final draft of this article and putting it in your newspaper. ________________________________________Monday: Read the prompt below and write a hook, transition sentence, and thesis. brainstorm one example per HELPS for each of your reasons that you could use to support your stance.Informational Essay Prompt = Cause and EffectThe medical advances of the Twentieth Century have many beneficial effects for humanity.Prompt: Think about an important medical breakthrough. How has the discovery/invention of __________________ affected society?Paragraph 1Hook:Transition sentence:Write thesis (restate prompt + 2 reasons): DIRECTIONS: use a computer to find examples with LOTS of details for the HELPS chart to support the above prompt. You must have AT LEAST 3 examples for each reason in your thesis (total of 6).HHistorical Examples**EEveryday News -Current Events**LLiterature/ Magazines/ Movies/ TV Shows**PPerson you know / Personal Experience**SSports / Science**________________________________________Tuesday: Use the Description text structure to write your essay. Plan which HELPS best support your thesis and where they will be in your essay. Use an outline or the shapes tool to create the graphic organizer here.Example: Outline TemplateI. CauseA. Effect (reason 1)i. Support (HELPS)ii. Support (HELPS)II. CauseA. Effect (reason 2)i. Support (HELPS)ii. Support (HELPS)_______________________________________________________________________CREATE IT HEREUsing your organizer above, draft your 1st body paragraph (paragraph 2). Remember, in your 1st body paragraph, focus on the 1st of your two reasons from your thesis statement and use HELPS to support it. Your conclusion should remind your reader of your points without repeating and include a reworded thesis statement. Draft your first body paragraph here: ________________________________________Wednesday:Continuing to use your organizer above, draft your 2st body paragraph (paragraph 3). Remember, in your 2nd body paragraph, focus on the 2nd of your two reasons from your thesis statement and use HELPS to support it. You will also write your conclusion (paragraph 4). Your conclusion should remind your reader of your points without repeating the information and should include a reworded thesis statement. Draft your second body paragraph here:Draft your concluding paragraph here:Thursday: Today you will put together all of your four drafted paragraphs into one solid article below. You will then use your ARMS and CUPS checklist and tasks below to revise and edit your article. Copy and paste your full article here:ARMS and CUPS:1. Highlight in yellow a sentence/word you added. 2. Highlight in blue a sentence/word you need to remove. 3. Highlight in green a sentence/word you need to move.4. Highlight in pink a sentence/word that you need to substitute.5. Highlight in purple word(s) that you need to add capital letters to.6. Highlight in dark blue words that are used too much and need to be replaced.7. Highlight in grey where punctuation marks need to be added. 8. Highlight in teal words that need to be spelled correctly.________________________________________Friday: You will follow the directions in your newspaper template PowerPoint to add your second article to your newspaper. Please give me the correct answer *20 POINTS*What took place off the coast of Brazil that would lead to Ferdinand Magellans fleet of five ships being reduced to four ships? Why do you think this happened? Sale! 25% OFF of the original price! Laura wants to buy a sleeping bag. The original price is $56. How much will Laura pay if she buys it during the sale. A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False Right answer will get brainlist