bynummeeks24

10/08/2020

BiologyHigh School

answered

Which of the following best describes how a channel protein moves materials across the membrane? A)They provide a carrier for specific molecules to bind to and cross the membrane via endocytosis. B)They provide a passage for specific molecules to cross the membrane via passive transport. C) They provide a tunnel for solutes to cross the membrane via active transport. D) They provide energy needed for solutes to cross the membrane via facilitated diffusion.

Answers

Answer 1

The correct option that best describes how a channel protein moves materials across the membrane is B) They provide a passage for specific molecules to cross the membrane via passive transport.

Channel proteins are integral membrane proteins that form channels or pores in the cell membrane. These channels allow the passive transport of specific molecules or ions across the membrane down their concentration gradient. This process is called facilitated diffusion, where the molecules move from an area of higher concentration to an area of lower concentration without the need for energy input. The channel proteins provide a selective passage for these molecules, enabling their movement across the membrane.

Therefore, the correct answer is B) They provide a passage for specific molecules to cross the membrane via passive transport.

For more details regarding passive transport, visit:

https://brainly.com/question/29764225

#SPJ4


Related Questions

Can someone plz help me out. I don’t really understand this.

Answers

7. b and 8. c i attached the photo for u to see how i did it

How does erosion and deposition shape the landscape?

Answers

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

Explanation:

have a good day/night

may i please have a branlliest

Which claim about reproduction in dogs can best be supported using a valid argument?
A. Offspring produced by sexual reproduction are genetically identical.
B. Gametes from both dogs are needed to maintain the correct number of chromosomes in the offspring
C. Phenotypic variation will occur in the offspring as a result of mitosis in the gametes.
D. Binary fission is required for sexual and asexual reproduction in dogs.

Answers

Answer:

b

Explanation:

In the photo of the house; What is happening to the foundation of
the house?

Answers

Answer:

errosion is causing it to crumble and become unstable

The article named Apes' Simple Nests Are Feats of Engineering. Where the author talks about how apes make their nest and how they use it. Apes make their nest in which they sleep during the night. Roland Ennos of the University of Manchester says that their nests look man -made and it was thought that apes do know how to use wood to make their nests.They also talk about the length and width of the nest. It takes 10 min for an ape to make their nest. From a new study they observe that some apes have a nest similar to bent nests attached between trees and some have oval-shaped nests on the tree branches where they sleep . On the other hand chimps also make similar nests like aps but according to an article it states that chimps sometimes sleep on the ground while aps doesn’t. Chimpanzee nests give a new way to research more on how they make their nest on ground by using some wood, plants and grass to make it comfy rather than on trees that maybe there were less quantities of trees or maybe they have different behavior than others.

Answers

The Apes' Simple Nests Are Feats of Engineering article is about how apes build their nests and how they use them. Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not.

According to the article, it was believed that apes were unable to make nests using wood; however, Roland Ennos of the University of Manchester stated that the nests look man-made. The article also mentions the size of the nest, which is usually large enough for the apes to sleep in at night. It takes only ten minutes for an ape to create its nest. In a recent study, researchers observed that some apes construct nests that resemble bent nests linked between trees, while others construct oval-shaped nests on tree branches where they sleep.
Chimps, like apes, build comparable nests, but they also occasionally sleep on the ground, whereas apes do not. Chimps' nests provide a new avenue for exploring how they build nests on the ground using wood, plants, and grass to make them more comfortable, which may be due to a lack of trees or different behavior.

To know more about Engineering article visit:

https://brainly.com/question/31525727

#SPJ11

Which are steps that could be used to solve 0 = 9(x2 + 6x) – 18 by completing the square? Check all that apply.
18 + 81 = 9(x2 + 6x + 9)
18 + 9 = 9(x2 + + 6x + 9)
18+ 36 = 9(x2 + 6x + 36)
11 = (x + 3)2
= (x + 6)2
342 =
V99 = (x +
Nbbff

Answers

Explanation:

What is the name of this website

or the book?

Answer:

A and D

Explanation:

What is the function of stabilizing proteins?​

Answers

Answer:

Stabilization of a protein translates into preservation of the protein structure during storage, in thermodynamic equilibrium with its surrounding

Explanation:

mark me brainlest

Which part of the female reproductive system is highlighted below?
A. Fallopian tube
B. Ovary
C. Uterus
D. Cervix

Answers

Answer:

C. Uterus

Explanation:

Uterus is the female reproductive system.

What is Female reproductive system?

The female reproductive system serves a number of purposes. It aids in sexual reproduction in addition to enabling sexual activity.

You make eggs using your ovaries. During ovulation, these eggs are subsequently moved to your fallopian tube where sperm fertilization may take place. The fertilized egg is then transferred to your uterus, where the lining of the uterus has expanded due to the typical hormones produced during your menstrual cycle, also known as your reproductive cycle.

The fertilized egg can implant into the thicker uterine lining once it's within your uterus and continue to grow there. Your menstrual period causes the uterine lining to shed if implantation doesn't occur.

Therefore, Uterus is the female reproductive system.

To learn more about Uterus, refer to the link:

https://brainly.com/question/9778292

#SPJ7

This plant is used to treat liver ailments during the medieval times
Liverworts
Hornworts
Mosses
Ferns

Answers

Answer:

liverworts

Explanation:

Answer:

liverworts

Explanation:

that's were it got its name because of it healing properties

what does it mean to be purebread ?

Answers

Answer:

If you meant purebred, it means that the species had not been bred with any other species than it`s own.

Ex: a purebred dog bred with another purebred dog produced a purebred offspring

a purebred dog bred with either another species of dog, or a crossbred dog will produce a crossbred offspring

Explanation:

in addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by choose one: a. serving as a channel for export of the cholera toxin. b. releasing antimicrobial agents to kill members of the normal microbiota. c. transmitting signals to communicate with other v. cholerae. d. binding to the promoters of genes involved in virulence. e. injecting effectors directly into the cells of the intestinal epithelium.

Answers

In addition to providing structural support and mediating transport, membrane proteins are important for allowing bacteria to sense and respond to changes in their environment. for example, the toxr protein is found in the plasma membrane of vibrio cholerae cells. it responds to ph and temperatures characteristic of the human gut environment by c. transmitting signals to communicate with other v. cholerae

Membrane proteins not only provide structural support and mediate transport but are also important for allowing bacteria to sense and respond to changes in their environment. The toxR protein is found in the plasma membrane of Vibrio cholerae cells. It responds to pH and temperatures characteristic of the human gut environment by transmitting signals to communicate with other V. cholerae. The ToxR protein is a transmembrane protein that is vital for the pathogenesis of Vibrio cholerae, the causative agent of cholera.

It functions as a transcription factor and regulates the expression of many virulence genes. ToxR, ToxS, and TcpP are three regulatory proteins that are essential for the transcription of virulence genes in Vibrio cholerae. They function as a complex to activate or repress transcription of genes that are important for the virulence of this bacterium. Therefore, option C, transmitting signals to communicate with other V. cholerae is the correct answer.

Learn more about transcription at

https://brainly.com/question/13673064

#SPJ11

wykonaj tabele w której porównasz funkcje wszystkich rodzajów elementów morfotycznych krwi

Answers

Is this a question or just a prank?

the step of translation in which release factors bind to a stop codon is

Answers

The step of translation in which release factors bind to a stop codon is termination. During this step, the ribosome recognizes the stop codon and triggers the release of the newly synthesized polypeptide chain along with the dissociation of the mRNA and ribosome.

Translation is the process of converting genetic information stored in mRNA into a sequence of amino acids that make up a protein. It is divided into three stages: initiation, elongation, and termination. During termination, the ribosome recognizes the stop codon (UAA, UAG, or UGA) in the mRNA, and a protein called a release factor binds to the A site of the ribosome. This causes the polypeptide chain to be released from the ribosome and folded into its final shape. Finally, the mRNA and the ribosome dissociate from each other. The newly synthesized protein can then undergo further modifications before being transported to its final destination in the cell.

Know more about stop codon, here:

https://brainly.com/question/30104870

#SPJ11

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

Describe: How does a virus destroy the host cell’s DNA?

Answers

Answer:

it eats away at the host from the inside

Explanation:

ECOTOXICOLOGY
6. Discuss the differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology 7. Suggest detailed reasons why dysregulation can lead adverse effects

Answers

Ecotoxicology is a branch of environmental toxicology that investigates the effect of toxicants on organisms in the ecosystem. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

6. The differences between dysfunction and destruction of target molecules as commonly used in ecotoxicology.

Dysfunction in ecotoxicology is a type of effect that results from the change in the normal physiological activity of a cell, tissue, or organ. It occurs when the toxicant alters the normal functioning of the target molecule. For example, when a pesticide such as DDT is ingested by an organism, it binds to the sodium ion channels in the nervous system, resulting in the impairment of the nervous system.The destruction of target molecules, on the other hand, is a type of effect that results from the direct alteration of a molecule's structure. It occurs when the toxicant physically alters the chemical structure of the molecule. For example, lead adversely affects organisms by binding to proteins and altering their structure.

7. Reasons why dysregulation can lead to adverse effects

Dysregulation can lead to adverse effects in several ways, including: It affects the normal functioning of the organism and can lead to death.It can result in the accumulation of toxic substances, causing long-term damage to the organism's health.It can lead to the overproduction of certain substances that cause harm to the organism.It can disrupt normal physiological processes, leading to disease and other health problems. Therefore, dysregulation has the potential to lead to serious adverse effects on an organism's health. In conclusion, the understanding of the difference between the destruction and dysfunction of target molecules in ecotoxicology and the knowledge of how dysregulation can lead to adverse effects are crucial for understanding the impact of toxic substances on organisms.

To know more about ecotoxicology visit:

https://brainly.com/question/32533210

#SPJ11

can anyone help me with this question?

Answers

Answer: Organic chemicals can contribute to local and regional losses of freshwater biodiversity and ecosystem services. ... Organic chemicals were likely to exert acute lethal and chronic long-term effects on sensitive fish, invertebrate, or algae species in 14% and 42% of the sites, respectively.

Explanation:

Why does asexual reproduction produce offspring with less diversity and therefore LESS chance of adapting to its environment​

Answers

Answer:

Sexual reproduction provides genetic diversity because the sperm and egg that are produced contain different combinations of genes than the parent organisms. Asexual reproduction, on the other hand, does not need sperm and eggs since one organism splits into two organisms that have the same combination of genes.

Explanation:

Explanation:

With asexual reproduction rather then there being two parents there is one. So the offspring is just a clone of the singular parent. This means there isn't a second set of genes or dna to mix into the child which would create changes and adaptions by inheritance. Though since there is one parent it is a clone of the first with nothing to inherit so it can't adapt as it only has the one set of genes instead of two.

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. What type of evidence would provide the best support for this claim?
A.evidence showing birds shared similar habitats with dinosaurs
B.evidence showing birds shared similar nutritional requirements as dinosaurs
C.evidence showing birds shared similar behaviors with dinosaurs
D. evidence showing birds shared a common genetic history with dinosaurs

Answers

Answer: D.

Explanation: I don’t really know how to explain it, I just know it’s right

Some scientists claim recent evidence suggests birds should be reclassified to share more taxonomic groups with dinosaurs. The liable options seems evidence showing birds shared a common genetic history with dinosaurs. The correct answer is option D.

What is the class of birds ?

It is the class aves that belong to the kingdom Animalia.

The birds and the dinosaurs have the same genetic history that is the phylogenetic relationship of both the species is almost same and they both show a similar set of characteristics.

They had multiple set of characteristics that were similar to both and they shared the common characteristics. The points are written as following :

1.Egg Laying

2.Scales

3.Feathers

4.Beaks

5.Diets

6.Reptilian Relations

7.Three-Toed Limbs

8.Claws.

These were the common characters that were present in both the categories.

Learn more about birds at :

https://brainly.com/question/25120645

#SPJ2

A simple guideline to follow for deloading is to train at less than intensity and less than volume of what is used during a standard training session. A. 40%, 40% B. 50%, 50% C. 70%, 70% D. 80%, 80%

Answers

The guideline recommends using 50% of the intensity and 50% of the volume of what is typically used during a standard training session. Therefore, option B is correct.

When deloading, it is recommended to train at a lower intensity and lower volume compared to a standard training session. The recommendation is to employ 50% of the volume and 50% of the intensity that is generally used during a typical training session.

This technique enables to provide a period of reduced stress on the body. It allows for recovery and adaptation to occur.

Learn more about intensity, here:

https://brainly.com/question/17583145

#SPJ4

ANSWERRR FAST Earthquakes happen as a result of:

Two continental plate's converging

Two oceanic plate's converging

Two tectonic plates transforming
( i have more questions!!!)

Answers

Answer:

Hey mate......

Explanation:

This is ur answer.....

Two tectonic plates transforming

Hope it helps!

Brainliest pls....

Follow me! ;)

if transported to the pm, will the c-terminus of this protein be extracellular or intracellular?

Answers

If a protein is transported to the plasma membrane (PM), the location of its C-terminus will typically be intracellular. This is because the C-terminus of most proteins is synthesized first and is usually oriented towards the cytoplasm during protein synthesis and maturation.

To determine whether the C-terminus of a protein will be extracellular or intracellular if transported to the plasma membrane (PM), we need to consider certain factors.

The location of the C-terminus depends on the protein's structure, function, and the orientation of the plasma membrane.

Proteins that are transmembrane proteins, meaning they span the plasma membrane, have both N- and C-termini positioned in different cellular compartments.

The N-terminus is typically located intracellularly, while the C-terminus faces the extracellular space.

In general, proteins that are involved in cell signaling, cell adhesion, or receptor functions often have extracellular C-termini.

These proteins interact with the extracellular environment to transmit signals or bind to ligands.

On the other hand, proteins that participate in intracellular processes, such as enzyme activity or cytoskeletal organization, often have intracellular C-termini.

These proteins function within the cell and may interact with other intracellular components.

Therefore, if the protein in question is known to be a transmembrane protein and its C-terminus is essential for its function or interaction with extracellular factors, it is likely that the C-terminus will be extracellular when transported to the plasma membrane.

However, if the protein primarily performs intracellular functions, the C-terminus would be oriented intracellularly.

It's important to note that the specific protein and its characteristics would ultimately determine the orientation of the C-terminus in the plasma membrane.

The orientation of the C-terminus in the plasma membrane would depend on the specific protein and its structural and functional characteristics.

Additional information about the protein's structure, localization, and function would be needed for a more precise determination.

For similar question on plasma membrane.

https://brainly.com/question/25978989

#SPJ8

I need help not sure

Answers

Answer:

The answer is 2

Explanation:

D,H,J are closely related because they are sharing traits, and it is the most relevant answer

HELP ME

Explain how physical variation is expressed in human beings and how it relates to cultural groups and ethnicity?!??

Answers

Be careful with those links there hackers

state any one way of controlling the spread of ringworms among children​

Answers

Answer: Teach kids not to wear each other's hats, and make sure each family member uses their own comb and brush. Other basic hygiene practices, like not sharing razors, can help prevent the spread of ringworms

CREDIT: everydayhealth

!! This was taken from a website, make sure to give credit or else it will be plagiarism !!

Which kingdoms contain organisms that have cell walls?

Answers

The plantae,Protista, eubacteria kingdom. I think it’s just the 3.

The function of cell wall is to provide protection. The kingdoms which have cell walls are  fungi and plantae.

What is the function of cell wall ?

The cell wall provides the protection against the  mechanical stress and the pressure that a cell membrane can not handle.

Cell wall is majorly present for the purpose of protection to the species and these species tend to be delicate and tend to be in more danger.

Cell wall of fungi is made up of chitin and it is polysaccharide having the amino glycosidic linkages.

Cell wall of plants is made up of polysaccharides as well where the cellulose is present in chains.

Cellulose provides the tensile strength and this amino  glycosidic linkages tend to provide strong skeletal structures in order to provide protection to the specimen.

Therefore only plantae and fungi have the cell walls.

https://brainly.com/question/965751

#SPJ6

What percent of energy is transferred between the levels indicated by the blue arrows?

A. 50

B. 90

C. 100

D. 10

Answers

The answer to the given question is that more than 100 percent of energy is transferred between the levels indicated by the blue arrows.

This is because the blue arrows show the flow of energy between trophic levels in an ecosystem and there is always a loss of energy in each transfer due to metabolic processes like respiration and incomplete digestion.The transfer of energy between trophic levels of an ecosystem is known as the energy pyramid. In general, only 10% of the energy at one level is available to the next level. For example, if the primary producers contain 10,000 units of energy, then only 1,000 units of energy will be transferred to the primary consumers.

However, some energy can be lost due to factors such as heat loss from the body of organisms, incomplete digestion, and inefficiencies in energy transfer mechanisms. Therefore, it is possible for more than 100% of energy to be transferred between the levels indicated by the blue arrows. Therefore, the correct answer is not given in the option, it is more than 100 percent.

To know more about percent visit:

https://brainly.com/question/14809038

#SPJ11

what factor may contribute to the higher food insecurity on the african continent,in the middle east,and in asia?

Answers

Answer:

The most common causes of food insecurity in Africa,middle east and asia: population growth, drought, extreme weather events and other agricultural problems.

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

How many chambers does a dog's heart
have?

Answers

Answer:

There are four chambers in the dog's heart: two top chambers (the atria) and two bottom chambers (the ventricles).

Explanation:

Answer:

It has 4 chambers

Explanation:

sorry if im wrong

Other Questions
Which of the following expenses/costs will not decrease the ending balance of a cash budget? a. Interest charges b.Withdrawals by the owner c. Sales discounts d. Depreciation expense which one of the following defines the core value of critical reading in the rhetorical analysis process? The current price of a bushel of No. 1 Hard Red Winter Wheat is 5. The risk free rate is 2%. Storage costs are 4%. Find the six month futures price. (Answer: 5.1478) Please show how this problem is solved. Which activities may discourage some people from purchasing a hybrid vehicle? Check all that apply. A)digging into the earth to search for metalsB)paying premiums to recharge car batteriesC)disposing of large amounts of hazardous wasteD)converting coal plants into other industrial plantsE)consenting to auto mechanics recycling old batteries based on nuclear stability, what is the most likely product nuclide when nitrogen-13 undergoes decay? 4 Judith has recently taken out a mortage for $175,000 at a rate of 3.2%, compounded semi-annually, with an amortization period of 22 years. How much interest will she pay in the 40th month? Her payments are monthly. A $401 B $493 C $508 D $414 ____________ skills include competencies such as listening, nonverbal behavior, and business etiquette. Fiscal policy is sometimes used during recession as a way to increase output by shifting aggregate demand to the right and reduce unemployment What are some of the drawbacks of such policy that usually takes place in real data? a. An increase in the deficit (or a reduction in the surplus) of government budget. b. The next expansionary period is usually followed by an increase in the surplus (or cutting the deficit) by raising taxes, which reduces aggregate demand, and raises unemployment. c. Politicians are often reluctant to raise taxes next period to finance the deficit created by cyclical fiscal policy which can contribute to higher levels of overall national debt. d. A and C are correct. What percentage of total tax expense is currently payable for each year? a barbershop staffed with only one barber receives an average of 20 customers per day. the mean service time averages about 20 minutes per customer. assuming that the customer arrival follows a poisson distribution and the service time follows an exponential distribution. answer the following questions knowing that the barber works only for 8 hours a day: if a guy walks into this barbershop, what is the average number of customers in the barbershop he should expect to see? The curves show the marginal cost (MC), average variable cost (AVC), and average total cost (ATC) functions for a firm in a competitive market. Using the straight-line tool, draw a straight line, all the way from the left edge of the graph to the right edge, to represent the minimum price at which the firm should continue operating. How many peaks are there in a perfectly U-shapeddistribution? A PPF is a straight line as a result of Select one: a constant opportunity costs b. increasing opportunity costs C. decreasing opportunity costs. d. scarcity. e choice. The languages with which paul was familiar in his day were _____ . hebrew latin greek aramaic Mama's Mexican Meals, Inc., had the following activity for an inventory item during June:UnitsUnitCostBeginning inventory50$10Purchase (June 5).1016Purchase (June 15)3014Sale (June 20).40Sale (June 25).20Purchase (June 30)1020Assuming Mama's uses a perpetual weighted average cost flow assumption, cost of goods sold for June would be In the table the profit y (in units of R10000) is shown for a number of values of the sales of a certain item (in units of 100). I 1 2 3 698 Y Make use of the Lagrange method for the derivation of an interpolation polynomial in order to show that a maximum profit is obtained for a specific value of x and then find this maximum profit. The Dahlia Medical Center has 32 labor rooms, 18 combination labor and delivery rooms, and 4 delivery rooms. All of these facilities operate around the clock. Time spent in labor rooms varies from hou Describe a hypothetical situation where aprospect has raised objections to yoursales pitch, and how you dealt with thoseobjections.You are required to1. Describe what was being sold2. Describe the prospects' objection3. And finally, describe how youhandled those objections ? You are considering going to graduate school for a 1-yearMasters program. You have done some research and believe that theMasters degree will add $5,000 per year to your salary for thenext 10 Which one of the following changes would cause the pressure of a gas to double assuming volume and moles were held constant?A) Increasing the temperature from 20.0 C to 40.0 C.B) Decreasing the temperature from 400 K to 200 K.C) Increasing the temperature from 200K to 400K.D) Decreasing the temperature from 40.0 C to 20.0 C.