Answer:
Bacteria can evolve quickly because they reproduce at a fast rate. Mutations in the DNA of bacteria can produce new characteristics and that the bacterium will grow better than its neighbors and can increase in numbers..
Explanation:
N/A
Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help
Distinguish between dimorphic, polymorphic, and continuously variable traits.
Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:
Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.Continuously variable traits are those that show a continuous distribution of phenotypes.Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.
Learn more about polymorphic traits here: https://brainly.com/question/7882029
in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze
Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.
Answer:
A. There would be an overpopulation of caterpillars, which would threaten the oak trees
Explanation:
Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!
Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.
Answer: B
Explanation:
Answer:
I think A! Sorry if wrong!
14. The active site of an enzyme
a. Is where the semi-permeable membrane is located
b. Is a specific bulge of protuberance on an enzyme
C. Is a groove or crevice in the structure of the enzyme into which the substrate fits
d. Rigidly resists any alteration of its shape
The active site of an enzyme
a. Is where the semi-permeable membrane is located
b. Is a specific bulge of protuberance on an enzyme
C. Is a groove or crevice in the structure of the enzyme into which the substrate fits
d. Rigidly resists any alteration of its shape
Answer:-C. Is a groove or crevice in the structure of the enzyme into which the substrate fits.
Explanation:-The active site is one such gap or pocket to which the substrate adapts and binds to the enzyme.
The active site is the region of the enzyme to which the substrate molecule binds and causes a chemical reaction. The active site is composed of amino acid residues that form a temporary bond with the substrate.
A biological factor that is correlated with borderline personality disorder is:
a)
a high level of testosterone.
b)
a low level of serotonin.
c)
a high level of serotonin.
d)
a low level of testosterone.
why are the offspring of coral identical to the parent
they reproduce sexually so offspring have increased genetic variation
they reproduce asexually so offspring have increased genetic variation
they reproduce sexually so offspring have decreased genetic variation
they reproduce asexually so offspring have decreased genetic variation
Answer:
they reproduce asexually so offspring have decreased genetic variation
Explanation:
when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!
Help help bell help help
more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell
Answer:
Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.
Explanation:
Answer:
Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.
Explanation:
Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.
Answer:
the female sea otter has 1
Explanation:
Describe the structure and function of areolar connective tissue.
Answer:
Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.
Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin
Answer:
Nervous system signal conduction in muscular movement
Explanation:
Hope i helped :)
PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.
Answer:
2-4 months for carrots and about 120 days for corn
Explanation:
Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.
Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).
Explanation:
All of the following would result in a population increase except
- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate
water vapor present in air support water cycle
The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?
Answer:
the phenotype of a mouse with genotype is g
Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well
Answer:
the first one
Explanation:
.
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Answer:
look at explanation
Explanation:
basically in order to go from mrna to trna just replace
a becomes u
g becomes c
u becomes a
c becomes g
1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization
Answer: a) exoskeleton
Explanation:
Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.
8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.
Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.
Answer:
B-Close the ring in the bearing or the ring in the bearing.
Explanation:
hope it's help
A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista
A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.
The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.
Flagellated protists are microorganisms having a tail-like projection known as flagellum.
The flagellum is a structure used for motion, thereby, in general, flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).
Learn more about the Protista kingdom here:
https://brainly.com/question/5186929
What are examples of devices that use electromagnetic waves? Check all that apply.
-FM radios
-microwaves
=TV remote controls
Answer:
FM radios and TV remote controls.
Which indicates a heterozygous genotype for smooth pods?
A. ss
B. SS
C. Ss
Answer:
C. Ss
Explanation:
One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.
pls help click the link answer
Answer:
1. Transfer
2. Share
3. Subscript
4. Positive
The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground
Answer:
it is 736
Explanation:
me big brain
Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.
The effects of road salting on the environmentRoad salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.
The types of salt used for road salting include:
rock salt, salt brine,winter sand, a mix of sand and salt.The impact of road salting on the environment include the following:
Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.Learn more about aquatic ecosystems here:
https://brainly.com/question/1023703
Where does carbon dioxide come from during photosynthesis?
Answer:
Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.
In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction
Answer:
The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.
Explanation:
The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.