can someone help me with this please ? D: 7th grade math

Can Someone Help Me With This Please ? D: 7th Grade Math

Answers

Answer 1

Answer:

2

Step-by-step explanation:

-6*-9=54

-9/-3=3 and 3 cubed=27

54/27=2

Answer 2
for this problem you would to order of operations:
Parenthesis
Exponents
Multiply
Divide
Add
Subtract

(-9/-3)=3
3^3=9
-6*-9=54
(a negative times a negative is a positive)
54/9
6!!!
hope this helps! have a great day!!!

Related Questions

Kenzie buys hair scrunchies. The cost for 20 scrunchies is $3.00.
The cost, c, for scrunchies is proportional to the number, n, of scrunchies.
Create an equation using n and c.
________________________________________________
Kenzie has $7.25. What is the maximum number of scrunchies she can buy?
______________________________

Answers

Answer:

48

Step-by-step explanation:

20 scrunchies=3 dollars

7.25 dollars = ?

1 dollar=6.66666666

0.25 dollar=1.666666666666

7*6.66666666=46.666666

:)

Answer:

Kenzie can buy 48 Scrunchies

Step-by-step explanation:

You have to divide 3 by 20. (3/20) Which is also 1.5/10 and as a decimal, that is 15 cents. So one scrunchie is equivalent to 15 cents, which means how many times can you take .15 from 7.25 is how many scrunchies she can buy. So how many times does .15 go into 7.25? The answer is 48.3(repeating). So you have to round it down because if you round it up she needs more money.

I hope that helped :)

when you divide a fraction less than 1 by a whole number greater than 1, is the quotient less than, greater than, or equal to the dividend> step by step please!!

Answers

Answer:

less than

Step-by-step explanation:

it would be less than

A line passes through (2, 8) and (4, 12). Which equation best represents the line?
1. y = 1/2x + 6

2. y = 2x + 7

3. y = 2x + 4

4. y = 1/2x + 10

Answers

y=2x+4 because we’re moving up 2 units for every unit we move to the right, and if we plug 0 in for X we end up with the +4
I would say 3 (I am not completely positive, I am not that smart with graphs)

X: (2 + 4) / 2 Equals: 3
Y: (8 + 12) / 2 Equals: 10
Then multiple 3 by 2 get 6, add four, you get 10 which is equal to Y

Which symbol makes the number sentence true?


A. <
B. >
C. =

Answers

Answer:

C: =

Step-by-step explanation:

-10/4 = -2.5

so C they're equal

Answer:

it is c

Step-by-step explanation:

they both are equal 10/4 =2.5 aswell

pls give me brainliest

The three oldest children need shoes. You find a store that has shoes on sale. All shoes in the store are marked $10 per pair. You have a choice of “Three for the price of two” or “Buy one and get 25% off the second.” Which of these is the best deal? Explain your reasoning.

Answers

Answer:

3 for the price of 2

Step-by-step explanation:

I had this question

Okay, they all equal 30 bucks. The first one would change into 20 bucks and the other would be Take off 10 by 30, 20,   20 with 25% off is 15. Then 15 + 10 is 25.

First one = 20.

Second one = 25.

Three for the price of two is cheaper.

The stained glass window shown is a half circle. What is the perimeter of the window? use 3.14 for π. Show your work.

Answers

Answer:

81.64

Step-by-step explanation:

]

40.82

1/2(3.14x26)

3.14(26)=81.64

81.64/2= 40.82

Two teams working together can finish a job in 8 days. if the first team works alone for two days and the second team works alone for 5 days, 5/8 of the total work still remains. How many days will it take each team to finish the work alone?

Answers

x is the days that the first team finishes the work alone (x>8)

y --------------------------second-----------------------------------------(y>8)

In a day:

The first team finishes 1/x (the work) The second team finishes 1/y (the work) Two teams working together finish 1/8 (the work)

⇒          [tex]\frac{1}{x}+ \frac{1}{y} =\frac{1}{8}[/tex]               (1)

If the first team works alone for two days and the second team works alone for 5 days, 5/8 of the total work still remains:

⇒          [tex]\frac{2}{x}+\frac{5}{y}=\frac{3}{8}[/tex]                (2)

(1),(2)   ⇒   [tex]\left \{ {{\frac{1}{x}+ \frac{1}{y} =\frac{1}{8}} \atop {\frac{2}{x}+\frac{5}{y}=\frac{3}{8}}} \right. <=>\left \{ {{x=16} \atop {y=24}} \right.[/tex]

It'll take the first team 16 days and the second team 24 days to finish the work alone

ok done. Thank to me :>

Show me how to do this on paper I need it right now

Answers

Answer:

Step-by-step explanation:

Billys mistake was when he multiplied the 80 by 12 instead of carrying the 1 from getting 160 from 80 x 2 he just put 16 and added 8 to it from 1 x 8.

what is the area of a parallelogram with a length of 9in and a height of 10in and a width of 8in

Answers

Answer:

72 sq in.

Step-by-step explanation:

I'm not sure what you mean, but it sounds like the base is 9 in, the side is 10 in, and the height is 8 in. If so, the area is 9 * 8 = 72 sq in.

Answer:

i think the person above is correct

Step-by-step explanation:

As a scuba diver dives deeper and deeper into the ocean, the pressure of the water on his body steadily increases. The pressure at the surface of the water is 14.7 pounds per square inch (psi). The pressure increases at a rate of 0.445 psi for each foot you descend.

Answers

Answer:

domain is the values in x axis and the range is the value in y axis

Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).
Which point lies on Line UV?

A. ( 7 , 12 )
B. ( 10 , 14 )
C. ( 16 , 22 )
D. ( 20 , 20 )

Answers

Answer:

D

Step-by-step explanation:

gradient is change in y/change in x

gradient of UV = 14-8/12+4=3/4

use equation y=mx+c where y is the y coordinate, m is the gradient, x is the x coordinate and c is the y intercept

use one of the coordinates of U or V, I'll use (4,8)

[tex]y = mx + c[/tex]

[tex]8 = \frac{3}{4} (4) + c[/tex]

[tex] 8 = 3 + c[/tex]

c is 5

the equation for UV is

[tex]y = \frac{3}{4} x + 5[/tex]

insert each X coordinate given in the question to see if it gives the same y coordinate

when x is 20, y is also 20 so the answer is D

the answer is D hope this helps

Kami is cooking dinner for a family reunion that 21 people are attending.
If her recipe calls for 1.6 ounces of ground beef per person, how much beef does Kami need altogether?
A. 12.6 oz
B. 13.125 oz
C. 22.6 oz
D. 33.6 oz

Answers

Answer:

it's D for sure.........

It could be 22.6 or 33.6 because if you do adding 21+1.6=22.6 and if you multiply 21x1.6=33.6

Kate has 2/3 yards of fabric to make small flags. Each flag requires 1/6 of fabric.
How man flags can Kate make?
You need to find how many _ are in _.

Answers

Answer: So Kate has 2/3 yard is fabric which is equal to 24 inches and if each flag requires 1/6 yards of fabric it would equal 12 inches. So all in all Kate can make 2 flags. Hope that helped.

Step-by-step explanation:

Answer:

you can make 4 flags

Step-by-step explanation:

you need to find how many 1/6 of 2/3

Courtney has $21.50 to buy a gift for her brother. She found a stuffed animal that costs $19.65. With 10.1% sales tax added on, what is the sales tax? What is the total cost of the stuffed animal with tax included? Will Courtney have enough money to buy the gift?

The sales tax is: $_________

The total cost is: $_________

Is it enough money?

Answers

Answer:

11.95

Step-by-step explanation:

21.50-19.65+ 10.1 = 11.95

what happens if you take 65% of $21.00 and compute 110% of the reduced price

Answers

Answer:

21.94

Step-by-step explanation: because i did some basic math

15.015- 21.00x0.65x1.1

what percentage is 879.75 of 900

Answers

the answer would be 97.75% all you have to do is divide 879.75 by 900 and multiply by 100

GIVING BRAINLIEST!! FAST-

Answers

Answer:

c'estla  A

Step-by-step explanation:

A pet store is having a pet fish sale. Lauren bought b balas and c catfish. Write an algebraic expression to represent the total cost of the fish. Use the chart to answer the question.

Answers

6b+4c=x
or
6(b)+4(c)=x

1/7 divided by 2/10 .

Answers

Answer:

5/7

Step-by-step explanation:

The answer is 5 over 7

True or False? The energy in a pendulum converts kinetic energy to potential energy, and then back again.

Answers

the answer to this question is true
the correct answer is “true”

What are the factors of 3a^(2)+10a-8

Answers

3a2-10a-8 =0
3a2-6a-4a-8=0
3a(a-2) -4(a-2)=0
(3a-2)(3a-4)
a= 2/3. ,. 4/3
3a (²)+10a-8
3a (²)+12a-2a-8
3a(a+4)-2(a+4)
Solution: (3a-2)(a+4)

PLEASE HELP FAST! DUE TODAY AND CANT HAVE A 0!

Answers

Answer:

ok so i think it is 5/9

Step-by-step explanation:

both equal 0.5 in decimal point

Answer:

The last option is correct

Step-by-step explanation:

Eg: i take  -4/9

If your answer id 4/-9 , the negative sign will always go on the top so answer will be -4/9

Thus its similar

Hope you understood

if not I will explain again !

Your welcome !

Write 28 x 32 in commutative property. No links!

Answers

32 x 28

you just have to flip them, and it'll be commutative! :D

pls help! i need this done in less than 20 minutes!

Answers

Answer:

46 units

Step-by-step explanation:

So first of all you do 8 × 2 which equals 16 units, then you do 15 × 2 which equals 30 units, then you 30 + 16 which equals 46 units. Hope this helps.

46 units
is the answer

I'm so bad at prime numbers. Help please !

Answers

Answer:

35111723

Step-by-step explanation:

17, 3, 23, 5, 11

3, 5, 11, 17, 23

35111723

Blacks car has traveled 100 miles in 1 an 1/4 hours. How many miles per hour in Blacks car traveling?

Answers

Answer:

[tex]\huge\boxed{\sf v = 80\ mph}[/tex]

Step-by-step explanation:

Given Data:

Distance = S = 100 miles

Time = t = 1 1/4 hours = 1.25 hours

Required:

Speed = v = ? mph

Formula:

v = S/t

Solution:

v = 100 / 1.25

v = 80 mph

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

A school assembly had 600 students in attendance, and 35% of them were first-graders. How many first-graders were at the assembly?

can u also list the formula on how to do this while ur at it pls and ty

Answers

Answer:

210 Were First Graders

Step-by-step explanation:

35 percent of 600 is the same as 35 per hundred of 600. We can therefore make the following equation:

35/100 = X/600

To solve the equation above for X, you first switch the sides to get the X on the left side, then you multiply each side by 600, and then finally divide the numerator by the denominator on the right side to get the answer. Here is the work to illustrate:

35/100 = X/600

X/600 = 35/100

X*600/600 = 35*600/100

X = 21000/100

X = 210

The work above shows the long way to explain how to calculate 35 percent of 600 in order to give you a foundation and better understanding of how to calculate percentage. In the future, you could use this simplified formula:

(Y * P)/100

In our problem "What is 35 percent of 600?", Y is 600 and P is 35:

(600 * 35)/100 = 210

And once again you see that the answer is 210.

Answer:

210 kids

Step-by-step explanation:

So the formula is basically part over whole is equal to x/100%

So for here it would be x/600 = 35/100

Solve that and you will get 210

i really need help someone pls help

Answers

5/6 is always going to my equal to itself. o divide the two and see what you get
1) 16
2) 12
3) 24
If you are trying to find the lcd I’m pretty sure those are right

Which of the following is a linear function? (1 point) HELP ME PLZZ

Answers

Answer:

Choice A (1st bubble)

Step-by-step explanation:

a linear equation results in a graph with a straight line.

First page, top

A linear function is a straight line.

Which number line plots the integers –2, 3, and 4?
A number line going from negative 5 to positive 5. Points are at negative 3, negative 2, and 4.
A number line going from negative 5 to positive 5. Points are at negative 4, negative 3, and 2.
A number line going from negative 5 to positive 5. Point are at 2, 3, 4.
A number line going from negative 5 to positive 5. Points are at negative 2, 3, 4.

Answers

Answer:

A

Step-by-step explanation:

becuase thats waht i think

Other Questions
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1 1. All the computer has a power button. Use the function below to find f(-2).f(x) = 5xO A. -25O B. 1/10O c. 1/25O D. -10 What is [tex]rs^{3}[/tex] divided by 8-2r if r=8 and s=3? A triangle has side lengths of 2 feet, 5.4 feet, and 5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Another triangle has side lengths of 3 feet, 8.1 feet, 7.5 feet. The angle measures are 90 degrees, 73 degrees, 17 degrees. Are the triangles similar? If so, what is the scale factor going from the top triangle to the bottom triangle? A 9-foot roll of waxed paper costs $4.32. What is the price per inch? What role did Thomas Catron play in women's suffrage in New Mexico?A.He steadfastly opposed women's suffrage. B.He did not take a stand for it or against it. C.He steadfastly supported women's suffrage. D.None of the above are true about Thomas Catron. Please help me! Some people have proposed a new way to build houses in areas that are likely to experience tsunamis. In this design, a house wouldnt have solid walls on all four sides. Instead, some of the wall areas would be replaced by substances that water can travel through quickly, as shown in the diagram. How would this design help a house survive a tsunami? What drawbacks might there be to this design?