Answers
Answer:
Integrated pest management (IPM), also known as integrated pest control (IPC) is a broad-based approach that integrates practices for economic control of pests. IPM aims to suppress pest populations below the economic injury level (EIL).
Related Questions
Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur
Answers
Explanation:
The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.
Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.
In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.
In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.
Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold
Glycolysis joins glucose to other molecules to make pyruvate. True or false
Answers
Answer:
false
Explanation:
The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.
Glycolysis is the first stage or process of cellular respiration in which -
one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysisC₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺ → 2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺
On the basis of the given explanation, it is evident that the given statement is a false statement.
Learn more about glycolysis:
https://brainly.com/question/10886602
A student will measure and record the growth (in height) of two flowering plants every other day for 20 days. Each plant will receive 200mL of water each day, but only one plant will receive 10mL of fertilizer. whats the independent variable, dependant variable, and the standardized variable?
Answers
Answer:
The correct answer is -
the independent variable - if fertilizer added or not,
the dependant variable - the height of the plant and
the standardized variable - 200ml water
Explanation:
In this study, the student wanted to see the effect of the fertilizer on the growth of the plant so the independent variable is the treatment of the fertilizer as manipulated or the independent variable is the factor which is affected or changed purposely during an experiment while other variables remain constant.
The dependent variable is the factor that is based or depends on the independent variable and measured to see the effect which is the height of the plants in this case.
The standardized or the control variable is the variable that remains constant throughout the experiment, 200 ml water treatment is the control variable in this experiment.
a 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?
Answers
Answer:
a great week to week to week to week I was
Explanation:
yhbbljgh
Use formula F=ma
* a= v/t
So F= m v/t
F=1000.25/10
F= 2500N
The internal urethral sphincter is comprised of
Answers
Answer:
1) the internal urethral sphincter (IUS), which consists of smooth muscle and is continuous with the detrusor muscle and under involuntary control, and 2) the external urethral sphincter (EUS), which is made up of striated muscle and is under voluntary control.
Explanation:
Hope this helped!
Prokaryotic cells are surrounded by a cell membrane.
True
False
Answers
Answer:
True
Explanation:
They are surrounded by a plasma membrane.
are unsaturated fats less healthy than saturated fats
Answers
Can someone find an example of mutualism in this passage? Please help I wasted all my points :)
Answers
Answer:
the coral and the algae
Explanation:
they both get positive things out of this so this is mutualism
can someone draw this for me and add the labels please thank you I suck at drawing
Answers
Answer:
Explanation:
sure, when is it due
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of
1) Chlorophyll
(2) carbon dioxide gas
(3) nitrogen gas
(4) oxygen gas
Answers
Answer: oxygen
Explanation:
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
What is chloroplast?Photosynthesis, the process by which light energy is transformed to chemical energy and results in the generation of oxygen and energy-rich organic compounds, takes place in the chloroplast, a structure found inside the cells of plants and green algae.
Close relatives of chloroplasts that are free-living are photosynthetic cyanobacteria; according to the endosymbiotic theory, these organisms are the ancestors of both chloroplasts and mitochondria, which are eukaryotic cells' energy-producing organelles.
Therefore, If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
To learn more about chloroplast, refer to the link:
https://brainly.com/question/11136550
#SPJ2
Suppose that the narrow‑sense heritability of ear length in Reno rabbits is 0.4. The phenotypic variance (VP) is 0.5, and the environmental variance (VE) is 0.1. Calculate the additive genetic variance (VA) for ear length in these rabbits.
Answers
Answer:
0.20
Explanation:
The narrow-sense heritability, denoted by h², refers to the ratio of additive genetic variance (Va) to the total phenotypic variance (Vp).
Mathematically, it can be written as:
h² = V(A)/V(P)
Where;
V(A) = additive genetic variance
V(P) = total phenotypic variance
V(A) = V(P) × h²
Based on the information provided in the question, V(P) = 0.5, h² = 0.4
V(A) = 0.5 × 0.4
V(A) = 0.20
The additive genetic variance (VA) for ear length in these rabbits is 0.2.
In gel electrophoresis, fragments are separated by size and electrical charge by applying __________ to them
Answers
Answer:
Gel matrix
Explanation:
Gel electrophoresis is a technique in molecular biology used to separate fragments of biomolecules such as DNA, RNA, protein by applying electric current through a GEL medium. The basis of separation of this fragments is their sizes and electrical charge.
In the gel electrophoresis procedure, a GEL medium made of Agarose is used. The DNA fragments, which are then negatively charged begins to move towards the positive end of the gel when electric current is supplied. The smaller fragments move/migrate faster than the larger ones towards the positive end. Therefore, In gel electrophoresis, fragments are separated by size and electrical charge by applying GEL to them.
Some grass species use the C3 photosynthetic pathway and other grass species use the C4 photosynthetic pathway. As you move from North Dakota to Texas, explain why you think the percentage of grass species using the C4 photosynthetic pathway would increase, decrease, or stay the same.
Answers
Answer:
would increase
Explanation:
C3 plants are those where the first carbon compound produced during photosynthesis have three carbon atoms per molecule (instead of 4 in C4 plants). While higher is temperature and light, oxygen (O2) exhibits a higher affinity for Rubisco, a key enzyme in photosynthesis. In environmental conditions with high temperatures and light such as, for example, Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants (because these plants have different metabolic pathways). Thus, it is expected that the percentage of C4 plant species in the local grass flora increases as latitude decreases.
It should be noted that the percentage of grass species using the C4 photosynthetic pathway would increase.
It should be noted that C3 plants simply refer to those where the first carbon compound produced during photosynthesis has three carbon atoms per molecule rather than the four carbon atoms that are in C4 plants.
In environments with high temperatures and light such as Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants. Therefore, it is expected that the percentage of C4 plant species in the local grass flora will increase when there is a reduction in latitude.
Read related link on:
https://brainly.com/question/18766174
15.Which of the following contain the genetic code? (Choose one: carbohydrates, nucleic acids, proteins).
16.Which of the following provide the most readily available energy? (Choose one: carbohydrates, lipids, nucleic acids, proteins).
Answers
Answer:
Protiens
Explanation:
because the DNA or RNA is translatted to sequence.
At which point during meiosis do haploid cells first appear?
A. metaphase I
B. anaphasel
c. metaphase II
D. anaphase II
Answers
Answer:
D. anaphase II
Explanation:
The telophase is followed by short interphase in which, however, no DNA synthesis takes place, so this phase is not real interphase, which is why it is also called interkinesis. It is followed by another meiotic division, which also consists of four phases marked as prophase II, metaphase II, anaphase II when the spindle fibers pull the chromatids for the opposite poles and telophase II and represent a true mitotic division.
D. anaphase II
Haploid gametes are produced during meiosis, which is a type of cell division that reduces the number of chromosomes in a parent diploid cell by half.
The telophase is followed by short interphase in which, however, no DNA synthesis takes place, so this phase is not real interphase, which is why it is also called inter-kinesis.
It is followed by another meiotic division,
Prophase II: Starting cells are the haploid cells made in meiosis I. Chromosomes condense. Metaphase II: Chromosomes line up at the metaphase plate. Anaphase II: Sister chromatids separate to opposite ends of the cell. Telophase II: Newly forming gametes are haploid, and each chromosome now has just one chromatid.Therefore, correct option is D.
Learn more:
brainly.com/question/16249478
CLICK HERE PLEASE HELP
Answers
Answer:
step 3
Explanation:
c
explanation:
What is the relationship between boiling point and pressure?
Answers
The boiling point of a liquid is the temperature at which its vapor pressure is equal to the pressure of the gas above it. The normal boiling point of a liquid is the temperature at which its vapor pressure is equal to one atmosphere. Microscopic view inside a bubble in boiling water.
what's the difference between polysaccharide and monosaccharides
Answers
Answer:
monosaccharide means a simple sugar such as glucose that has just one ring, whereas polysaccharide means a polymer made of many saccharides linked by glyosidic bonds
what are the two classes of cells found in the human body
a) muscular and nervous
b) bone cells and endocrine cells
c) sex cells and somatic cells
d) permanent and temporary
Answers
Answer: the answer is c
Explanation:
Different types of cells occurs in organisms. These cells differentiate right from the zygote stage to become more specialized as the individual grow.
The two classes of cells found in the human body include the sex cells and somatic cells (option C).
These two main classes encompasses all the various types of specialized cells. The somatic cells are also called the body cells. These cells are diploid in nature. While the sex cells are also known as the gametes. The sex cells include the sperm cell from the male and the egg cell from the female. In humans there are 22 pairs of body cells (autosomes) and a pair of sex chromosomes (XX for females and XY for males).Learn more about the sex and body cells: https://brainly.com/question/927903
production of oxygen during photosynthesis
Answers
Answer:
c
Explanation:
Imagine you were going to model the flow of energy in an ecosystem and the flow of elements in the ecosystem using a diagram
Compare and contrast your diagrams for these two systems.
Answers
Answer:
Only 10 percent of energy is transferred from one trophic to another while the elements transfer are proteins, carbohydrates and fats.
Explanation:
The flow of energy occurs in an ecosystem through a number of trophic. From the first trophic level to the second trophic level only 10 percent of energy is transferred while the rest of the energy is released in the form of heat energy. Flow of elements in the ecosystem refers to the elements that are essential for the survival of organism. These elements are present inside the foods which is eaten by these animals. Proteins, carbohydrates and fats are the elements transfer from one organism to another by eating the food.
Graphic organizer: Use the terms in the word bank to complete the graphic organizer below: Word Bank precipitate light substances chemical reactions properties color gas temperature
Answers
Hi, you've asked an incomplete question. Attached is the full image of the graphic organizer.
Answer:
chemical reactionssubstancespropertiesprecipitategascolortemperaturelightExplanation:
After merging the missing words together, we can make this likely conclusion:
First, when chemical reactions (1) occur, they often indicate new substances (2), that is formed with new properties (3).
Next, we also note that some evidence of a chemical reaction occurring includes:
↓formation of:
a precipitate (4), or
gas (5)
↓change in:
color (6)
temperature (7).
↓production of:
light (8) A good example of this occurs when one burns wood by applying heat, there's usually a production of light.
A smoke detector in a home uses what form of energy?
-solar
-chemical
-thermal
Answers
Answer: smoke alarm is a smoke detector that can detect small particles of smoke common in home fires. This detector is activated by monitoring the electronic energy between two battery-powered metal
Explanation: so chemical
What are the ways oxygen is transported in the blood, ranked according to the way that is responsible for the majority of transport of oxygen?
a. 1-dissolved in plasma, 2- Hb
b. 1-Hb, 2-HCO3, 3-dissolved in plasma
c. 1- dissolved in plasma, 2-Hb, 3-HCO3
d. 1-dissolved in plasma, 2-HCO3, 3-Hb
e. 1-HCO3, 2-Hb, 3-dissovled in plasma
f. 1- Hb, 2-dissolved in plasma
Answers
Answer:
f. 1- Hb; 2- dissolved in plasma
Explanation:
Transport of oxygen in the body occurs in two way; oxygen bound to hemoglobin and oxygen dissolved in plasma.
1. Bound to hemoglobin :
Hemoglobin, or Hb, is a protein molecule found in red blood cells and is responsible for the colour of red blood cells. It is composed of four subunits of two types of the protein globin: two alpha subunits and two beta subunits. Each subunit surrounds a central heme group (red in color) that can bind one oxygen molecule.Therefore, each hemoglobin molecule can bind and transport four oxygen molecules. About 98.5% of oxygen is transported in the body bound to hemoglobin.
2. Oxygen is only fairly soluble in blood plasma. As a result, only 1.5 percent of oxygen in the blood is dissolved and transported in blood plasma.
What is the term used for how antibiotics work?
A. Bacteriostatic
C. Bacteriosis
D. Bacteriocida
Answers
Answer:
I think it's bacteriostatic.
Help please I am begging I am stupid :(
Answers
Answer:
Explanation: b
Answer: if you need help get help
Explanation: help is like geting more egication and speed classes
have a nice rest of your day
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'
What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).
note: there are two answers for this question
Answers
Answer:
5'GATCGTAA3'
5'ATTCTAGA3'
Explanation:
As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.
Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.
DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.
Which process represents cellular division in body cells?
Answers
Explanation:
Cell division occurs during mitosis which means the chromosome pairs are split into two new cells.
The last two pictures show it in a visual way for you!
Hope this helps!!
The nutrient needed for growth and repair of body tissues is
carbohydrate
protein
mineral
Answers
Answer:
Protein is a nutrient used to make and repair our body cells (like blood and muscle cells). About 1/2 of your dry body weight is protein. If you do not eat enough carbohydrates, protein will be changed to carbohydrates so that you can get energy.
Answer:
protein
Explanation:
In which structure would you expect to find a chloroplast?
A. Blood cell from a dog
B. Cell from sunflower leaf
C. Human skin cell
D. Liver cell from a penguin
Answers
Answer:
b.cell from a sunflower leaf
The structure that can have chloroplast is the cell from sunflower leaf. The correct option is B.
What is chloroplast?Chloroplasts are chlorophyll-containing organelles found in plant cells; they are necessary for Earth life because photosynthesis occurs in chloroplasts.
Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, as well as other plastids.
Chloroplasts are plant cell organelles that use photosynthetic energy to convert light energy into reasonably stable chemical energy.
They survive life on Earth by doing so. Chloroplasts also perform a variety of metabolic functions for plant cells, such as the generation of fatty acids and membrane lipids.
Chloroplasts are found in all green plants and algae. Chloroplasts can also be found in photosynthesis that don't appear green, such as giant kelp's brown blades or certain plants' red leaves.
Thus, the correct option is B.
For more details regarding chloroplast, visit:
https://brainly.com/question/11136550
#SPJ6