Can you have a credit score of 900?

Answers

Answer 1

It's impossible to have a credit score of 900. A credit score of 850 is only feasible for 1% of people, therefore, attempting to achieve the maximum credit score possible is completely unrealistic after a certain point.

What is a Credit Score?A  number based on a person's credit history is attributed to their level of creditworthiness.Lenders evaluate the risk of lending money to an individual using the individual's credit score.The range of a credit score is commonly 300 to 850, with a higher number denoting a reduced risk.The availability of loans, credit cards, and other types of credit as well as the interest rate and credit limit can all be determined by a person's credit score.It's a record of your credit history, including whether you pay your payments on time, how many credit cards you have, what kinds of credit you use, and how much debt you have.If you apply for a loan or a credit card, the lender will look at your credit history before approving you.

To learn more about credit score from the given link :-

https://brainly.com/question/29548283

#SPJ4


Related Questions

Which of the following would find the most utility from GAAP accounting methodology?
A. Vendors
B. Doctors
C. Athletes
D. Households

Answers

D. Households would not find utility from GAAP accounting methodology.

What is GAAP?According to Generally Accepted Accounting Principles (GAAP), businesses and organizations must record, categorize, and summarize financial transactions as well as disclose financial information in a clear and consistent manner. Organizations and businesses use it mostly. Households would not find utility as the financial transactions and activities of a household would not typically be subject to the same reporting and disclosure requirements as a business or organization. Thus businesses and organizations that are publicly traded or seeking capital from public markets would find the most utility from GAAP accounting methodology, as it is a requirement for them to follow the standards.

To know more about GAAP , check out :

https://brainly.com/question/20693144

#SPJ1

How do corporations make financial disclosures about the corporation at the end of the financial year? Who benefits from this disclosure?

At the end of the financial year, a corporation has to make a disclosure of its__________. These documents help
__________ to make informed choices.

Answers

At the end of the fiscal year, a corporation must make a disclosure of its financial situation. These documents help stakeholders to make informed choices.

What are the benefits of financial disclosures?

By demonstrating its financial results at the end of the fiscal year, a corporation is able to create greater value for its stakeholders, such as its shareholders and customers, ensuring greater transparency about processes.

Financial disclosures also assist in compliance with legal compliance and help to gain more accurate knowledge of the company's real situation in terms of its finances, allowing for more effective decision-making.

Therefore, financial disclosures are capable of creating value for the company, attracting greater investment and business organization.

Find out more about financial disclosures on:

https://brainly.com/question/15281075

#SPJ1

In your teams, use the above guidelines to write a summary of the below interview. The interview subject
was a tax associate/accountant at PricewaterhouseCoopers. The interviewer was seeking information for
her portion of the Employment Outlook Report.
Remember that all team members must summarize their interviews. Collectively, these interviews should
all be an equal number of words written in a consistent style. Your team should also note any interesting
overlaps or surprising findings among all the interviews.
Original Interview Text. The U.S. Bureau of Labor Statistics gives similar job outlook projections for all
accounting and auditors. Similarly, the projected job growth is 13% with the mean salary falling around
$72,500.
Interview: Lucero Martinez, 22-years-old, tax associate/accountant at PricewaterhouseCoopers (PwC).
Q: What area of accounting is your focus in and what are some of the duties required?
A: My accounting focus area is tax accounting and in addition I have been working with the forensics team
as well. I assist in the administration of a settlement fund to compensate businesses that were affected
by the Deepwater Horizon oil spill of 2010. I am the primary reviewer and process Business Economic
Loss Claims, analyze variances between Profit & Loss statements versus Federal tax returns and make
calculations to determine compensation for claimants.
Q: Did your job require a specific level of education?
A: My specific job requires 150 credit hours including 30 advanced accounting hours. My firm
emphasizes the importance of a Certified Public Accounting license (which I am currently working on
obtaining).
Q: When you applied for your job was it in demand? Or is hiring more seasonal?
A: Accounting is always in demand! PwC specifically hired several interns and associates year-round! It's
an exciting field to be in!
Q: If you had any advice for future accounting professionals, what would it be?
A: Accounting isn't easy, but anything worth doing will not come easy! It's a great field to be in and
opportunities are endless so never be afraid to explore all of your options (government, public, academia,
industry accounting etc.). Talk to professionals, instructors, do internships, and learn. I recommend
reaching the State requirement of 150 credit hours to sit for the CPA. Obtaining this license will help you
advance your career at a faster pace! Attend socials because networking is key! Work hard and always
keep a positive attitude! Accounting is where you want to be. One thing for sure is that you will NEVER not
have a job in accounting.
IN A COMPUTER SCIENCE FIELD.

Answers

Instead of focusing on highlighting specific viewpoints or experiences, pay attention to clearly stating what was discussed in the interview.

How do you summarize an interview?

Instead of going into specifics regarding viewpoints or stories, focus on giving a concise description of what was discussed in the interview. Instead of paraphrasing what the interviewee said, the summary should serve as a roadmap for what can be learned from the conversation.

10 Tips to Help You Get Ready for an Accounting Interview

Identify Your "Why" What makes you desire to work as an accountant? ... Review Your Basics. Several common accounting interview questions are as follows: ... Create stories.

Show up early.

Be specific, demonstrate your value, research the business, and study your field.

Inform the truth.

Take the interviewer's advice to heart.

Never disparage a professor, friend, job, or your university.

Keep an eye on your grammar.

Be ready to answer some personal queries.

Keep quiet until the interviewer brings up compensation and benefits.

To learn more about interview refer to:

https://brainly.com/question/8846894

#SPJ4

Pay attention to clearly stating what was discussed during the interview rather than concentrating on highlighting particular points of view or experiences.

How can an interview be summarized?

Focus on succinctly describing the content of the interview rather than delving into specifics about points of view or narratives. The summary should be a roadmap for what can be learned from the conversation, not a paraphrase of what the interviewee said.

A structured conversation in which one participant asks questions and the other responds is known as an interview. A one-on-one conversation between an interviewer and an interviewee is referred to as an "interview" in common usage.

To learn more about interview refer to:

brainly.com/question/8846894

#SPJ4

Beth deposits $200,000 into her
personal savings account. How much of
her deposit is insured by the FDIC?
$50,000
$150,000
$200,000

Answers

Beth deposits $200,000 into her personal savings account. $ 50,000 more she need to deposit insured by FDIC.

Option A is correct.

For each account ownership category, the standard insurance amount is $250,000 per depositor, per insured bank. The FDIC covers deposits in different ownership categories in different ways.

What is the FDIC's role?

Deposits are protected by the FDIC; examines and supervises financial institutions for consumer protection and safety; makes it possible to resolve large and complex financial institutions; likewise oversees receiverships.

What is the FDIC and how significant is it?

The Federal Deposit Insurance Corporation (FDIC) is an independent government agency that safeguards insured deposits in the event of bank failure. The insurance provided by the FDIC is backed by the government of the United States. The National Credit Union Administration, which regulates and insures credit unions, is the other agency that provides deposit insurance to depositors in American depository institutions. The Federal Deposit Insurance Corporation is one of those two agencies .

Learn more about FDIC :

brainly.com/question/14308403

#SPJ1

If a company is using a skim pricing strategy and prices its product at a premium price, what happens with demand for its product

Answers

Since other companies will rapidly enter if they detect the product's available artificially high margins, skimming strategy might foster competition.

What is a skimming strategy for pricing?

Skimming is a pricing technique that involves setting initial product prices higher and then lowering them when rivals enter the market. Skim pricing is the reverse of price strategy, which sets low initial rates for newly released items in an effort to attract a large consumer base.

Skimming is a term used to describe reading quickly to get the gist of the material without paying attention to its deliberate and intricate meaning. Skimming will ensure that you make efficient use of your time while assisting you in finding the information swiftly.

To know more about skimming strategy, visit:

https://brainly.com/question/15371394

#SPJ4

What you give up in the future to make a purchase today?

Answers

When you make a purchase today, you give up the ability to use that money for something else in the future as investment. This is known as the opportunity cost of a decision.

What's better, purchase or investment?

The decision between making a purchase or investing the money depends on the individual's goals and priorities for investment A purchase may provide immediate satisfaction and the  opportunity cost to use the item or service right away. A purchase may not provide long-term financial benefits. Investment money can provide potential long-term financial gains, but it also involves some level of risk. investment money may not provide immediate satisfaction. It is important to consider both short-term and long-term goals when making a decision about whether to make a purchase or  opportunity cost of the money. It's important to weigh the potential benefits and drawbacks of each option. It's recommended to consult with a financial advisor before making any investment decisions.

To learn more about the investment visit:

brainly.com/question/15105766

#SPJ4

What are the advantages of earning your own money to purchase something special? explain the advantages using specific details and examples in your response?

Answers

When people use their own money to buy something exceptional, they will spend less, value it more, and be inspired to repeat the action.

What is the importance of earning in life?

You can establish a business, create the home of your dreams, support your family financially, and pursue other objectives you think would improve your quality of life if you have money.

It aids in the acquisition of some of life's intangibles, like freedom or independence, the chance to fully utilize our abilities and skills, the power to choose our own course in life, and financial security. Money allows for a lot of good deeds and the avoidance or end of avoidable misery.

You wait and save your money, and when you do, you'll get double as much as you did before. and that is the first benefit of making your own money and purchasing wonderful things with it.

Therefore, the answer is:

The advantages of people earning their own money to purchase something special are they will spend less money, value it more, and they will have the motivation to do it again.

To learn more about earning money refer to:

https://brainly.com/question/24556197

#SPJ4

Economists view the fact that Florida grows oranges, Texas pumps oil, and California makes wine as Oa. confirmation of the infant-industry argument. O b. confirmation of the virtues of free trade. O c. confirmation that specialization in absolute advantage works. O d. confirmation that free trade agreements are not necessary.

Answers

The fact that California produces wine, Texas produces oil, and Florida produces oranges is seen as evidence of the benefits of free trade by economists.

California is a state on the west coast of the United States. It is the third-largest state in terms of area and has the most residents in the US, with over 39.2 million people living there in a total area of around 163,696 square miles. It ranks as the 34th most populous subnational entity on the earth and is the most populous in North America. The Greater Los Angeles Area and the San Francisco Bay Area are the second and fifth most populated urban areas in the US, with over 18.7 million and over 9.6 million inhabitants, respectively. The second-most populous metropolis in the US and the most populous city in the state is Los Angeles, which has its headquarters in Sacramento.

Learn more about California from

brainly.com/question/26015261

#SPJ4

Within the textbook, the idea that goods would be equally distributed if the distributor was not allowed to know of his/her status or position is referred to as: Group of answer choices

Answers

Within the textbook, the idea that goods would be equally distributed if the distributor was not allowed to know of his/her status or position is referred to as veil of ignorance .

By preventing decision-makers from accessing potentially biased information regarding who will profit most or least from the various options, the "veil of ignorance" is a moral reasoning tool intended to encourage unbiased decision-making.

Justice's guiding principles are selected under the cover of ignorance. By doing this, it is made sure that no one will be favored or disadvantaged in their choice of principles based on the results of natural chance or the contingency of social situations. The parties are given full knowledge of their society, including each member's preferences, under a utilitarian veil of ignorance.

To know more about veil of ignorance visit :

https://brainly.com/question/1286519

#SPJ4

Peanut Company acquired 100 percent of Snoopy Company’s outstanding common stock for $300,000 on January 1, 20X8, when the book value of Snoopy’s net assets was equal to $300,000. Peanut uses the equity method to account for investments. Trial balance data for Peanut and Snoopy as of December 31, 20X8, are as follows:

Answers

As of December 31, 20X8, Peanut and Snoopy's liabilities and equity were 1288000.

Which is preferable, equity or equality?

For fairness and justice to be upheld as well as for each member of society to be able to reach their full potential, equality and equity are necessary. As opposed to equity, which aims to provide everyone with everything they need to have fair opportunities to those possibilities, equality makes sure that everyone is provided the same opportunities.

How does equity work in Example?

Equity can be used to a single property, such as real estate or to a corporation and is calculated by deducting liabilities from assets. The difference is $100,000 represents equity, for instance, if a homeowner has a home worth $400,000 but owing a mortgage of $300,000.

To know more about equity visit:

https://brainly.com/question/28336002

#SPJ4

Think about all the jobs that you encounter on a daily basis. How many different types of career paths intersect with your life every day? List as many different jobs and career paths that you see on a daily basis. Which ones, if any, interest you and why?

Answers

Answer:

I can provide you with a list of common jobs that may intersect with an individual's daily life:

Retail salesperson

Customer service representative

Delivery driver

Food service worker (e.g. server, chef, bartender)

Receptionist

Teacher

Health care worker (e.g. nurse, doctor, therapist)

Construction worker

Police officer

Office worker (e.g. administrative assistant, project manager)

I can provide information about different careers and what they entail. If you have specific questions about a particular career or job, I would be happy to help.

Explanation:

the waverly brush company issued 4000 shares of common stock worth 20000000 total what is the par value of ewach satere

Answers

The par value of each share would be $5.00. Par value, also known as "face value" or "nominal value," is the value assigned to a stock or bond by the issuing company.

It is usually a very small fraction of the market value of the stock or bond, and it is used as a reference point to determine the minimum price at which the stock or bond can be sold.

For common stock, the par value is often set at a very low dollar amount, such as $0.01 or $0.001 per share. It is important to note that the par value has no relationship to the market value of the stock, which is determined by supply and demand forces in the market.

This is calculated by dividing the total value of the issued shares ($20,000,000) by the number of shares issued (4,000).

$20,000,000 / 4,000 = $5.00 per share.

Learn more about par value, here https://brainly.com/question/30157327

#SPJ4

Select all that apply.

Which of the following skills are important for job interviews?

thinking

writing

listening

speaking

Answer : Select all got 100% on edge

Answers

Answer:

the answer is all of the above.

Explanation:

because you need all of these traits in order to do job interviews.

Final answer:

Success in job interviews depends on a combination of skills, including thinking, writing, listening, and speaking. Each of these skills contributes to your ability to effectively respond to interview questions, demonstrate your competency, and highlight your suitability for the role.

Explanation:

All of the skills listed - thinking, writing, listening, and speaking - are indeed important skills for job interviews. Thinking skills are important in order to logically and effectively answer the questions your interviewer is asking. Writing skills can be crucial in interviews, particularly if you're asked to complete a task or test.

Listening skills are critical because they indicate how well you pay attention to instructions and tasks. And finally, speaking skills are necessary to effectively communicate your thoughts, experiences, and ideas.

Learn more about job interview skills here:

https://brainly.com/question/34001263

#SPJ2

Economic guided reading 7-3

Answers

The economy fluctuates between periods of expansion (growth) and contraction, which is referred to as the "economic cycle," sometimes known as the "business cycle" (recession).

What is Economic cycle?

The present stage of the economic cycle can be determined using variables like gross domestic product (GDP), interest rates, total employment, and consumer expenditure.

Since the economic cycle directly affects stocks, bonds, profits, and corporate earnings, understanding it can help investors and businesses decide whether to invest and when to withdraw their funds.

The stage of the economic cycle we are in at the moment can be determined by variables like GDP, interest rates, total employment, and consumer spending.

Therefore, The economy fluctuates between periods of expansion (growth) and contraction, which is referred to as the "economic cycle," sometimes known as the "business cycle" (recession).

To learn more about economy refer to the link:

https://brainly.com/question/2421251

#SPJ1

One advantage of a partnership is (A) ease of formation. (B) limited liability. (C) unlimited life of the partnership. (D) limited vision and skills.

Answers

One advantage of a partnership is ease of formation which means option A is correct answer.

Partnerships have a long history and were used in the Middle Ages in both Europe and the Middle East. According to a 2006 article, the first partnership was formed in 1383 by Prato and Florence-based industrialist Francesco di Marco Datini. The Del Buono-Bencivenni company (1336-1401) and the Covoni company (1336-1401) have both been referred to as early partnerships even though they were not legally recognized as such. The 13th century saw the start of Europe's Commercial Revolution, which included partnerships. In the fifteenth century, the cities of the Hanseatic League helped one another; a ship from Hamburg to Gdansk would not only carry its own cargo, but was also contracted to transport goods for other league members.

Learn more about partnership here:

https://brainly.com/question/19988417

#SPJ4

What is the real definition of risk?

Answers

Risk is the idea of future uncertainty regarding departure from anticipated earnings or outcome. Risk is a measure of how much uncertainty an investor is willing to accept in order to make a profit from their investment.

Risk can be defined as the chance that anything negative will occur. Risk is uncertainty about how an action will affect something that people value (such as their health, well-being, wealth, property, or the environment), frequently focused on unfavorable outcomes.

Risks come in a variety of forms and come from various circumstances. Risks include those related to liquidity, sovereign risk, insurance, business, and default. The uncertainty caused by numerous elements that influence an investment or a scenario gives rise to a variety of hazards.

know more about insurance here

https://brainly.com/question/27822778#

#SPJ4

Which of the following is an advantage of the user support group form of training?
A) Usually conducted in an informal social setting B) Formal training plan C) Can be live, or can be archived and viewed at the trainee’s convenience D) Can be customized to the needs of the trainee

Answers

Answer: correct answer is A usually conducted in an informal social setting is an advantage of the user support group form of training.

Explanation: It helps them to become more skilled and more productive.

If an investor maintaining a short equity option is assigned an exercise notice, which of the following statements is true

Answers

Option D is correct, she must accept the exercise notice. Once exercised, a contract may not be traded to another individual. The assigned party must either deliver (for a call) or buy (for a put) the stock in two business days (regular way settlement for stock transactions).

What is Exercising Options?

An American-style option holder has the choice to buy (in the case of a call) or sell (in the case of a put) the shares of stock that the option is based on.

Prior to doing so, they must instruct their brokerage company to send an exercise notice to OCC. Option holders must notify their brokerage company before the deadline for accepting exercise instructions on that day in order to guarantee that the option will be exercised on that specific day.

When an option holder wants to exercise an option, the brokerage firm notifies the OCC. The exercise notice is then given to a clearing member at random by OCC. This is often the investor's brokerage firm, which was randomly selected from a group of brokerage firms. The company is then required to designate one of its clients who has written (but not covered) that specific option.

Either at random or according to the principle of first-in-first-out, customers are assigned. Depending on the firm's methodology. Find out how your brokerage company handles assignments by asking them.

To know more about exercising options visit:

https://brainly.com/question/13211375

#SPJ4

How does the placement affect the hyper cycle?

Answers

Explanation:

The placement of robotics can makeother items in the hype cycle move to the peak of inflated expectations.

The contribution uton margin per unit expressed as a percentage of the product's selling price is th A. Volume variance B. Margin of safety.
C. Contribution margin ratio. D. Break-even point. E. Rate of return on sales.

Answers

The contribution margin ratio is the contribution uton margin per unit represented as a proportion of the product's selling price.

Providing something as a part or share, such as through a donation or the provision of something (such money or time). Money is being gathered to support the scholarship fund. By contributing (anything, including cash, goods, or time) — generally + to or toward — someone, a group, a cause, or an organization, you can show your support. Contribution is the difference between revenue and variable production costs. Formulae: Contribution is equal to total income minus all variable costs. Contribution per unit is equal to the selling price per unit less variable costs per unit. The volunteers helped clean up the city during their free time. Everyone's support would be greatly appreciated as we work to raise funds for a new school. He didn't contribute anything to the project. 

Learn more about contribution  from

brainly.com/question/26734546

#SPJ4

The accounting records of Nettle Distribution show the following assets and liabilities as of December 31, 2016 and 2017. December 31 2016 2017 Cash $ 64,300 $ 15,640 Accounts receivable 26,240 19,100 Office supplies 3,160 1,960 Office equipment 44,000 44,000 Trucks 148,000 157,000 Building 0 80,000 Land 0 60,000 Accounts payable 3,500 33,500 Note payable 0 40,000 Required: 1. Prepare balance sheets for the business as of December 31, 2016 and 2017. (Hint: Report only total equity on the balance sheet and remember that total equity equals the difference between assets and liabilities. )

Answers

The total assets are $377,600 and the total liabilities are $73,500, resulting in total equity of $304,100.

What is asset?

An asset is an economic resource that has a measurable value and can be owned, managed and exchanged.

December 31, 2016
ASSETS
Cash $64,300
Accounts Receivable 26,240
Office Supplies 3,160
Office Equipment 44,000
Trucks 148,000
Building 0
Land 0
Total Assets $285,600

LIABILITIES
Accounts Payable $3,500
Note Payable 0
Total Liabilities $3,500
EQUITY
Total Equity $282,100
December 31, 2017

ASSETS
Cash $15,640
Accounts Receivable 19,100
Office Supplies 1,960
Office Equipment 44,000
Trucks 157,000
Building 80,000
Land 60,000
Total Assets $377,600

LIABILITIES
Accounts Payable $33,500
Note Payable 40,000
Total Liabilities $73,500

EQUITY
Total Equity $304,100

The balance sheets for Nettle Distribution as of December 31, 2016 and 2017 show the total assets and total liabilities of the company. The total equity is the difference between the total assets and total liabilities. In 2016, the total assets are $285,600 and the total liabilities are $3,500, resulting in total equity of $282,100. In 2017, the total assets are $377,600 and the total liabilities are $73,500, resulting in total equity of $304,100.

To learn more about asset
https://brainly.com/question/28931542
#SPJ4

The use of outsourcing is primarily designed to reduce _____________ for the business that is implementing this strategy

Answers

Costs is right option. The use of outsourcing is primarily designed to reduce Costs  for the business that is implementing this strategy

Outsourcing is a strategy used by businesses to reduce costs by shifting certain processes, such as manufacturing, to outside providers. Outsourcing allows businesses to focus on their core competencies, reduce overhead costs, increase efficiency, and potentially increase profitability. Additionally, it can help businesses access specialized expertise and services they may not have the resources or capabilities to provide in-house.

To know more about outsourcing here

https://brainly.com/question/11441512

#SPJ4

if a producer is not able to expand its plant capacity immediately, it is____

Answers

Factory expansion requires huge investments, and it takes time for all companies to make such investments. If producers cannot expand their factories, they will take short-term action.

The plant capacity is the saturation point. The maximum force a plant can produce. Fixed costs are constant costs. It does not change with the level of production of goods and services. Gross cost of production corresponds to variable cost of production. In the long run, all costs will fluctuate. Because in the long run you have enough time to convert all fixed inputs to variable inputs.

Therefore, total costs correspond to variable costs in the long run. Finally, marginal cost increases as production increases because the marginal product of labor decreases. Capacity factor: It is the ratio of the energy actually produced to the maximum energy that could have been produced in a given time period. The plant capacity factory gives the inverse capacity of the plant.

Know more about investments here:

https://brainly.com/question/15353704

#SPJ4

When launching a new clothing line, a company must focus primarily on the needs and wants of ______. Multiple choice question. competitors corporate partners consumers suppliers

Answers

When launching a new clothing line, a company must focus primarily on the needs and wants of c) consumers.

A consumer is a person or a group that isn't directly involved in entrepreneurial or business operations and who intends to order or uses bought particulars, products, or services primarily for particular, social, family, or ménage requirements. The expression is most constantly used to describe someone who makes purchases for their own use.

A consumer in an frugality purchases goods or services primarily for particular use rather than for resale or for marketable objects. guests spend plutocrat on products or services.

As a result, consumers are an essential element of any frugality and play a pivotal part in the profitable system of a commercial society. Without consumer demand, manufacturers wouldn't have one of their primary driving forces the desire to vend their goods to consumers.

To know more about consumer:

https://brainly.com/question/27773546

#SPJ4

Briefly describe why retailing is an effective component in the private enterprise system.
PLEASE HELP FAST​

Answers

Buys products from a wholesaler and resells them to consumers or the product's end purchaser. Given that a large portion of our economy is driven by consumer spending, retail sales are a crucial economic indicator.

Consider all the people and businesses that are engaged in the manufacture, marketing, and sale of the products you use on a daily basis, such as food, clothing, gasoline, and so forth. Effective retail managers are well-versed in the goods and services they sell. It enables them to recommend products to economy when they are aware of the qualities and advantages of what they sell. A retail manager also informs their sales personnel of brand-new goods and services.

To learn more about economy, click here.

https://brainly.com/question/2421251

#SPJ4

a(n) ________ scholar explores communication with the ultimate goal of changing society.

Answers

a critical scholar explores communication with the ultimate goal of changing society. A collection of people engaged in constant social interaction is referred to as a society.

A society is a collection of people that regularly contact with one another or a significant social group that inhabits the same physical or social region and is generally under the control of the same political leadership and prevailing cultural norms. A given society may be defined as the sum of all of these interactions among its constituent members. Societies are characterized by patterns of relationships (social relations) between people who share a certain culture and institutions. In the social sciences, subgroup domination or stratification patterns frequently appear in bigger societies. By designating particular behaviors or ideas as acceptable or undesirable, societies create patterns of behavior.

learn more about society here:

https://brainly.com/question/13295832

#SPJ4

A businessperson is returning from a trip to china and has 409.31 yuan in their wallet. the most current currency conversion rate is 1 u.s. dollar:6.4651 yuan. how much money will the businessperson have when they convert their money to u.s. dollars?
a. $2646.23
b. $415.78
c. $402.84
d. $63.31

Answers

A businessman with 409.31 yuan in their wallet is coming back from a vacation to China. The most recent exchange rate is 1 US dollar to 6.4651 Chinese yuan. When the businessperson will convert their money to u.s. dollars, he will have $63.31.

What do you mean by exchange rate?

The worth of one currency in respect to another, or the rate at which one currency will be exchanged for another, is known as a currency's exchange rate.The foreign exchange market, often known as Forex or FX, which is a worldwide decentralised market for the trading of currencies, determines the exchange rates of such currencies.

Most currency conversion rate is 1$ = 6.4051 yuan

So, 409.31 yuan  = 409.31  - 6.4051

                             =  $63.31

So, The correct option is D.

To learn more about exchange rate:

https://brainly.com/question/2202418

#SPJ4

For stability and economic reasons, we operate the transmission line with power angle in the range of:

Answers

The load, torque, or power angle is the name given to this lagging angle. " stands for it. The maximum torque angle required for stable functioning is 90°, or 0° to 90°.

What does a transmission line power angle mean?

The power angle is the angular relationship between the internal and terminal voltages of a generator or the voltages at the source and load points of an electrical transmission line.

What does the power angle mean and why does it matter in the power system?

When the power angle of a synchronous machine is changed, the Power Angle Curve provides information about its electrical power output. As we climb from 0 to 90°, the output grows sinusoidally, as can be seen from this chart. But a power angle that is more than 90 degrees.

To know more about power angle visit :-

https://brainly.com/question/7956945

#SPJ4

What are 3 scarce economic resources?

Answers

Three scarce economic resources are land, labor, and capital.

The land is a finite resource, meaning that there is only a certain amount of it available. It is used for agriculture, housing, and industry, and it is a key factor in economic production.

Labor is another scarce resource, as it encompasses the physical and mental abilities of individuals that are used to produce goods and services. Capital is the third scarce resource and consists of the money, goods, and machinery used in production. This includes items such as machinery, buildings, computers, and other tools used to produce goods and services.

For more questions like Economic click the link below:

brainly.com/question/30104243

#SPJ4

What is pure market economy?

Answers

Answer: A pure market economy is one that does not use state force to function as an efficient producer of goods and services

Explanation: This type of economic system was never really seen in practice before the Industrial Revolution.

Other Questions
Irv cant sleep, so he makes himself a cup of warm milk with a spoonful of honey in it. Will this work? (Points : 4) a. No. Tell him to buy some sleeping pills from the drug store. b. Kind of. Therell probably be a placebo effect. c. Yes. Milk contains tryptophan, which promotes sleep. d. Yes, but it will disrupt his sleep cycle. Your colleagues computer stops working, and no one from the IT department is available to fix it. You have basic knowledge of computer hardware. Which action should you take as an ethical employee? A. Initiate help by offering to check the computer. B. Start a conversation with your colleague and provide a distraction. C. Take a quick break and offer your computer for a short time. D. Ignore it because it is beyond your designated scope of work. Assume the demand curve for product X shifts to the right. This might be caused by: a. an increase in income if X is an inferior good. b. a decrease in the price of Y if X and Y are complementary goods. c. a change in consumer tastes which is unfavourable to X. d. a decline in the price of Zif X and Z are substitute goods. What is the best evidence we have for evolution ? Quadrilateral FGHI is similar to quadrilateral JKLM. Find the measure of side JK. Figures are not drawn to scale. I need to show work please help me its due tomorrow What are 6 major technological advances of ww2? Select the correct answer. which gas is the most abundant greenhouse gas? a. ozone b. chlorofluorocarbon c. carbon dioxide d. methane e. water vapor What type of lines will be presented by the system of equations 2x 3y 6 and 4x 6y 11? Suppose a historian wants to estimate the true mean number of children per household in New York City in 1900. The historian randomly selects 200 household census records from New York City. She records the number of children residing in each household. The historian then computes the mean number of children per household among these 200 households. For every described currently living species of organism, there are about ________fossil species.O 2O 1/6O 100O 6O 1/100 Checkpoint 4 is -117 and checkpoint 3 is -212 how much higher is checkpoint 4 than 3 PLSSS HELP IF YOU TURLY KNOW THISS Please help asap people kept giving me wrong answers. Due tonight in a couple hours +25ptsES = ___ unitsRound your answer to the nearest tenth. jacks meeting stared at 2:45 pm and ended at 5:25 pm how long did the meeting last Today, most nations, like the United States support...isolationism.democratic-socialism.internationalism.communism. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Is the simplified form of 2 square foot 3. Square Foot 12 rational II. Rewrite the given sentences in their present continuous2. Rahul receives an award on the children's day. PLEASE HELP!!The equation of a circle is (x+10)2+(y4)2=100.What is the center and radius of the circle?Responses center: (10, 4); radius: 10,000 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10,000 center: , begin ordered pair negative 10 comma 4 end ordered pair, ; radius: 10,000 center: (10, 4); radius: 10 center: , begin ordered pair 10 comma negative 4 end ordered pair, ; radius: 10 center: (10, 4); radius: 10