Cattle and other ruminants have evolved to eat grass. What problem has emerged as a result of feeding
corn to cattle instead?

Answers

Answer 1

Explanation:

Since corn was very cheap, the farmers raised cattle on corn also believing that the cows would gain more weight, therefore, more product or supply for them to sell. However, this resulted in the cows begin developing a disease called E. Coli, which then leads to social issues.

Answer 2

Answer:

the cattle are more on a risk of health diseases

Explanation:

because corn has nutrients but not enough of each to provide the cattle the nutrients it needs


Related Questions

5. What natural phenomenon converts nitrogen into the form which organisms can use?

Answers

Answer:

the nitrogen cycle

Explanation:

Explain your observations. What did you observe as you added phenolphthalein to the ammonia solution? What did you observe when vinegar was added?

Answers

Answer:

Liquid ammonia is liquefied ammonia and is basic in nature. It dissolves in water to give ammonium hydroxide which ionizes to give hydroxyl ions. Therefore it turns red litmus blue and phenolphthalein solution pink.

74 POINTS!!!!
How could addressing market failure help make an economy more environmentally sustainable?

Answers

Answer:

If companies are held accountable upfront for the consequences their actions will have on the environment, their actions may be more environmentally friendly from the beginning.

what is occurring during the s phase of the cell cycle?

Answers

The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA. In this way, the genetic material of a cell is doubled before it enters mitosis or meiosis, allowing there to be enough DNA to be split into daughter cells.

Pls give brainliest ❤️

21. Three different processes are occurring in the drawing below. Name each process and describe it.

Answers

Answer:

Process A is diffusion

- diffusion is the random movement of molecules from the area where there is more of them to an area where there is a few of them without the input of energy.

Process B is facilitated diffusion

- facilitated diffusion is the transport of substances across a cell membrane from an area of higher concentration to a lower concentration with the help of Transport protein

Process C is active transport

- A ctive transport is when an input of energy is required to move materials through a cell membrane .

74 POINTS!!!!!!!!
Do you think we should attempt to
quantify and assign market values
to ecosystem services and other
entities that have only non-market
values? Why or why not?

Answers

Answer:

yes

Explanation:

yes because I like the same thing cuz you just like doing like what you have to do and I did it already and I got it a

A bar graph and a pie graph are the same thing.

A. True
or
B. False​

Answers

Falseee !!! I'm suree
B. False
Pie charts show how much each category represents as a proportion of the whole and Bar graphs use a series of rectangular bars to show absolute values or proportions for each of the categories

what is the role of microfilaments in cell division

Answers

Answer:

. Microfilaments help the cell lay down new membrane and divide into two daughter cells.

Explanation:

all female mammals have one active x chromosome per cell instead of two. what causes this?

Answers

Answer:

maybe its because of pregnancy

Explanation:

where are the proteins of the electron transport chain located in a eukaryotic cell?

Answers

Answer:

In eukaryotes, the electron transport chain is located in the inner mitochondrial membrane. In prokaryotes, it is located within the plasma membrane

hii everyone i have question again which substances made gages​

Answers

What is the question???

nucleic acids are assembled in the _____ direction.

Answers

5’ to 3’ hope this helps:)

Nucleic acids are assembled in the 5' to 3' direction during DNA replication. DNA replication is the process of duplication of DNA molecule.

What are Nucleic acids?

Nucleic acids are the biomolecules occurring in the chemical compounds which serve as the primary information-carrying molecules in the cells. Nucleic acids play an important role in directing the process of protein synthesis. The two main classes of nucleic acids include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Nucleic acids can only be synthesized in vivo in the 5′-to-3′ direction and these can be assembled in the same direction in cell, as the polymerases which assemble various types of new strands generally rely on the energy which is produced through breaking the nucleoside triphosphate bonds to attach these new nucleoside monophosphates to the 3′-hydroxyl (−OH) group, through a phosphodiester bond.

Learn more about Nucleic acids here:

https://brainly.com/question/11309892

#SPJ6

how can an understanding of osmosis be important in developing methods for the same storage of food?

Answers

Osmosis is also used for preserving fruits and meats, though the process is quite different for the two. In the case of fruit, osmosis is used to dehydrate it, whereas in the preservation of meat, osmosis draws salt into it, thus preventing the intrusion of bacteria.

skeletal muscle exhibits alternating light and dark bands called

Answers

Skeletal muscle exhibits alternating light and dark bands called a sarcomere

Skeletal muscle is having sarcomere having myofibrils which appear dark and light in the microscope.

What is skeletal muscle?

Only thin filaments containing actin are present in isotropic bands, anisotropic bands are the darker bands (A bands).

Repeating sarcomere sections, which are visible under the microscope as alternating dark and light bands, make up myofibrils.

When a muscle contracts or relaxes, long, fibrous protein filaments called sarcomeres glide past one another. Because of this, skeletal muscle is also known as striated muscle.

Therefore in appearance due to myofibrils composed of the sarcomere look light and dark bands in the skeletal muscle under a microscope.

Learn more about skeletal, here:

https://brainly.com/question/29215804

#SPJ2

quién me ayudaría a hacer este crusigrama
gracias ​

Answers

Answer:

Respuesta: hola ami me parece que ya lo hiciste pero te dejo ejemplos:

Explicación: 1.Venezuela

2. Sanclemente

3. Marroquin    

me das corona plis chau

Explanation:

How are male and female reproductive organs similar?

Answers

Answer: They are the same in that most of the reproductive organs of both sexes develop from similar embryonic tissue, meaning they are homologous. Both systems have gonads (male have testes and female have ovaries) that produce gametes (testes produce sperm and ovaries produce egg or ovum) and sex organs.

How is the word Representation used in a sentence

Answers

Answer:

A graphical representation of results is shown in figure 1. 17. He gave a talk on the representation of women in 19th-century art. ... He is writing a book on the representation of woman in medieval art

The painting is a representation of a storm at sea.

OR

Representation is the act of speaking on someone's behalf, or depicting or portraying something. When a lawyer acts on behalf of a client, this is an example of representation.

which term describes the ability of neurons to process information, store and recall it, and make decisions?

Answers

Answer:

Neural Integration

Explanation:

:)

easy - one giving brainly if correct AND DETAILED!
please give me at least 2.​

Answers

Well you see theres this guy named MrBeast thats taking little kids money and is having one of his slaves eat a water bottle for every dollar

Answer:

Well recently Team Seas has come out for every dollar donated I think it's 1 pound of trash so by donating would be one.

The second would be volunteering to help clean up for example a beach.

For more lasting impact would be to have a machine that collects the trash at where the rivers and streams meet the ocean this will lead to less trash in the ocean. There is a great example of this machine by Mark Rober gives a detailed explanation.


Concentration of water in a solution outside the cell is 30% The concentration of
water inside the cell is 70%. In what direction will the solvent move if diffusion
occurs? Is energy required?

Answers

Answer:

water will move out of the cell,energy is required

Explanation:

water moves through osmosis which is the movement of water molecules from a region of higher concentration to a region of lower concentration.

what does the doctor inject into the child to make the child immune to measles​

Answers

Answer:

MMR vaccine

Explanation:

CDC recommends that children get MMR vaccine to protect against measles, mumps, and rubella.

Whales and hippos are thought to have evolved from a common ancestor around 54 million years ago. Which of the following is also true about these species?

Answers

Answer:

Both whales and hippos have almost no hair on their bodies. They do not have sweat glands.

Explanation:

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

#5 and 6 pleasee I will give you 100 points

Answers

6)it is bigger then we ever thought and that we wont beable to explore it all..

CORRECT ME IF I AM WRONG

6) it is bigger then we ever thought and that we wont beable to explore it all

sorry if this didnt help

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

the age of a woolly mammoth can be determined by examining what?

Answers

Answer:

examining the tusks, bones, teeth, (carbon levels in tissues depends)

Explanation:

Carbon-14 can be used to date the remains of dead organisms because all living things use carbon to build tissue.

The biological age of mammoths (also known as the "age at death") is usually estimated by comparison to correlations between the biological age and the wear stages of grinding teeth in extant elephants. As tusks grow, they continually incorporate ingested strontium (Sr), and the incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to investigate proboscidean movements

scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends)

What are Mammoth?

All living things need carbon to create tissue, making carbon-14 a useful tool for dating the remains of deceased species.

Mammoths' biological age, also known as the "age at death," is typically calculated by comparing it to correlations between that age and the phases of tooth wear in living elephants.

The incremental record of strontium isotope ratios (87Sr/86Sr) in tusks and teeth can be used to study proboscidean movements as tusks continuously integrate ingested strontium (Sr).

Therefore, scrutinizing the bones, teeth, and tusks (carbon levels in tissues depends).

To learn more about Mammoth, refer to the link:

https://brainly.com/question/24163999

#SPJ2

what do you call an organism that has been genetically engineered to contain a gene from a different species?

Answers

Answer:

A transgenic, or genetically modified, organism is one that has been altered through recombinant DNA technology, which involves either the combining of DNA from different genomes or the insertion of foreign DNA into a genome.

Explanation:

Answer:

This would be called a transgenic or genetically modified organism.

Explanation:

A transgenic or genetically modified organism is one that has been altered through something called recombinant DNA technology. Which involves either the combining of DNA from different genomes or in another case the insertion of foreign DNA into a genome.

The cell membrane is said to be semipermeable because

Answers

Answer:

The membrane is selectively permeable because substances do not cross it indiscriminately.

Explanation:

How does a substance cross the cell membrane in diffusion?
a- flowing down the concentration gradient
b- binding to a carrier protein
c- going through a pump
d- going through a channel protein
(ck-12)

Answers

Answer:

A

Explanation:

What are characteristics that are unique to wetlands?

Answers

Answer:

  Wetlands must have one or more of the following three attributes: 1) at least periodically, the land supports predominantly hydrophytes; 2) the substrate is predominantly undrained hydric soil; and 3) the substrate is saturated with water or covered by shallow water at some time during the growing season of each year.

Explanation:The minimum essential characteristics of a wetland are recurrent, sustained inundation or saturation at or near the surface and the presence of physical, chemical, and biological features reflective of recurrent, sustained inundation or saturation.

Other Questions
Simplify the expression to a + bi form:(11 + 9i)2 A brick is thrown upward from the top of a building at an angle of 25 degrees to the horizontal with an initial speed of 15 m/s. If the brick is in flight for 4 s before it hits the ground, how tall is the building? find x if m The cost of printing different numbers of copies of a book is shown on the graph below. Which equation represents the cost ,C, of printing n copies of the book? What is the author's main claim? What details of the text help to identify the claim? what is his angular displacement during a 1.0 s time interval? Sonar is a device that uses reflected sound waves to measure underwater depths. If a sonar signal has a frequency of 288 Hz and the speed of sound in water is 1450 m/s, what is the wavelength of the sonar signal? what is Photosynthesis??????????????????? HELP ME AND ILL GIVE U BRAINLIST I PROMISE BUT ITS ONLY IF U GET IT RIGHT Mother made a cake. the ratio of the flour is 2 cup to 1 cup. she used 4 cups of sugar how many cups of sugar did she use she chaired the meetingis it denotative language or connotative language? help please? anybody Anita is concerned that she'll be diagnosed with type 2 diabetes. What type of lifestyle change could she make to help prevent this diagnosis? What text structure or device does Lincoln use to contribute to the themes of the religious revivals: sin, sacrifice, and redemption? (AKS 14)A)Biblical allusionsB)Parallel structureC)AlliterationD)Cause and effect Why did the Stamp Act Congress meet in 1765?A) to form a new government for the coloniesB) to approve the taxes imposed by ParliamentC) to discuss how to respond to the new taxesD) to agree not to import British goods 0.4(-0.03) plz help metabolic water is one way human beings excrete water every dayTrue or False help me guys I need help ? Name the 12 Marshals of the French Empire. need help please All of the following are equivalent except _____.(-2) 4-2 4(-2)(-2)(-2)(-2)2 4