(Comparing Data MC)


The line plots represent data collected on the travel times to school from two groups of 15 students.

A horizontal line starting at 0, with tick marks every two units up to 28. The line is labeled Minutes Traveled. There is one dot above 10,16,20, and 28. There are two dots above 8 and 14. There are three dots above 18. There are four dots above 12. The graph is titled Bus 14 Travel Times.

A horizontal line starting at 0, with tick marks every two units up to 28. The line is labeled Minutes Traveled. There is one dot above 8, 9,18, 20, and 22. There are two dots above 6, 10, 12,14, and 16. The graph is titled Bus 18 Travel Times.


Compare the data and use the correct measure of variability to determine which bus is the most consistent. Explain your answer.


Bus 14, with an IQR of 6

Bus 18, with an IQR of 7

Bus 14, with a range of 6

Bus 18, with a range of 7

Answers

Answer 1

Answer:im not too sure but I think it was b

Step-by-step explanation:


Related Questions

(25 POINTS) Use the drop-down menus and enter values to complete the statements below.

Answers

Part A:
- X is greater than or equal to 4
- X=4 ; X=4 (or anything greater than 4)

Part B:
- X is less than it equal to -4
- X=-4 ; X=-4 (or anything less than -4)

Answer:

1. Greater than or equal to

2. a. 4 b. 4 or anything above four

3. Greater than or equal to

4. a. -4 b. -4 or anything above -4

Step-by-step explanation:

Hope this helps

I Truly don't understand this question please help me out... It don't give me the information I feel like I need.

Answers

Part A

c = 66 per dress

Part B

$396

Okay, here are the step-by-step calculations:

Part A:

You were given the number 66. So we entered that as the cost (c) per dress in the equation.

Part B:

We were asked to find the cost of 6 dresses.

So we calculate:

Cost per dress (c) = $66

Number of dresses = 6

Total cost of 6 dresses =

$66 x 6 = $396

So the final answer for Part B is: $396

In summary:

We were given: Cost per dress (c) = $66

and asked for cost of 6 dresses

So we calculated: Cost per dress (c) = $66

Number of dresses = 6

Total cost = $66 x 6 = $396

Does this help explain the steps? Let me know if you have any other questions!

HELLOO HELPP PLSS!!!!!!!!!!!!

Answers

Answer: 1

Step-by-step explanation:

factors mean numbers that multiply to make other number

1, 2, 3, and 4 are all factors of 36 because thye all go in evenly os

4/4=1

Need an answer ASAP!

Answers

Answer:

C) 11.5%

Step-by-step explanation:

Answer: C. about 11.5%

Explanation:

757.67÷670.50=1.13
1.13x10=11.3%

Triangle NMO is drawn with vertices N(−5, 2), M(−2, 1), O(−3 , 3). Determine the image vertices of N′M′O′ if the preimage is reflected over x = −5.

N′(5, 2), M′(2, 1), O′(3, 3)
N′(2, −5), M′(1, −2), O′(3, −3)
N′(0, 2), M′(3, 1), O′(2, 3)
N′(−5, 2), M′(−8, 1), O′(−7, 3)

Answers

N′(5, 2), M′(2, 1), O′(3, 3)
N’[5,2], M’[2,1], O’[3,3]
Hope im right

3. Write an expression to represent "6 more than y"

Answers

Answer: y+6

Step-by-step explanation:

In order to do this, we do 6 more than y. More than is going to be addition, and we get y+6 since it is 6 more than y.

I think the answer would be Y+6 I’m pretty sure

Match the following.

Column A
1. How should a polygon be constructed triangle?
2. How can you relate construction of polygons to your every day life?
3. Why is it important to know the different kinds of polygons?
4. What do we need to know for polygon?
5. What is the basic construction of polygons?

Column B
A. Three edges of equal legth and tree angles between each pair of edges to be bo degree.
B. The squared form of the tiles you walk on indicates that they are polygons.
C. They teach us how to make patterns, how to use polygons to make other shape.
D. The side must be straight.
E. A regular polygon is a polygon that us equiangular and equilateral.​

Answers

Answer:

Question 1 — Answer E

Question 2 — Answer B

Question 3 — Answer C

Question 4 — Answer D

Question 5 — Answer A

Step-by-step explanation:COLUMN — A (Questions)                 COLUMN — B (Answers)How should a polygon be construct a triangle?

ANSWER — A regular polygon is a polygon that is equiangular and equilateral.

How can you relate construction of polygons to your every day life?

ANSWER — The squared from of the tiles you walk on indicate that they are polygons.

Why is it important to know the different kinds of polygons?

ANSWER — They teach us how to make patterns, how to use polygon is to make other shape.

What do we need to know for a polygon?

ANSWER — The side must be straight.

What is the basic construction of polygons?

ANSWER — Three edges of equal length and three angles between each pair of edges to be 60 degree.


Hope my answer helps you.

:)

Please mark my answer as the BRAINLIEST. Plsssssssssssssssssss

I will add you as my friend if you mark my answer as the BRAINLIEST.

HELP ASAP PLEASE
I PUT THE FILE WITH THE PROBLEM HERE

Answers

Answer:

Growth, Growth, decay, decay, growth, decay, growth, decay

Step-by-step explanation:

Growth growth, decay, decay, growth, decay, growth, decay

pls help.....HEEEEELP

Answers

I think the answer is 29 cubic units.

12 on the bottom, 9 in the middle, and 8 on the top.

Determine the line of reflection.

Reflection across the x-axis
Reflection across the y-axis
Reflection across x = 6
Reflection across y = −4

Answers

Reflection across y=-4

Answer:

The answer is the 4th option! (Reflection across y = -4)

Step-by-step explanation:

If you have any questions please ask me! :)

Mrs. Williams has a prize box with different colored tickets.

Each ticket results in a different type of prize.
Pedro will randomly select a ticket, replace it, and then select another ticket.

What is the probability that he chooses a yellow ticket and then a purple ticket? This problem is based on Independent event problems.

Answers

Answer:

The probability that Pedro chooses a yellow ticket and then a purple ticket is A. 3/25

Answer:

The probability that Pedro chooses a yellow ticket and then a purple ticket is A. 3/25

PLEASE HELP NOW!!!!!


1 in 1/2 + 2 in 2/1 + 2 in 4/2 + 3 in 1/2 + 3 in 4/2 +?

Answers

15/2 i think in my opinion lol
i think the answer is 18 in

Use the graph to answer the question.

Graph of polygon ABCDE with vertices at negative 3 comma 3, negative 3 comma 6, 1 comma 6, 1 comma 3, negative 1 comma 1. A second polygon A prime B prime C prime D prime E prime with vertices at negative 5 comma 3, negative 5 comma 6, negative 9 comma 6, negative 9 comma 3, negative 7 comma 1.

Determine the line of reflection.

Reflection across x = −4
Reflection across y = 1
Reflection across the x-axis
Reflection across the y-axis

Answers

Answer:

The line of reflection is x = 4, since the line x = 4 divides the original polygon and its image into congruent halves.

Step-by-step explanation:

ABCDE polygon graph with vertices at bottom 1 comma 6, 1 comma 3, negative 1 comma 1, 3 commas, 3 commas, and 1 comma. cross-axis reflection.

A polygonal shape is what?

A polygon is a two-dimensional, closed structure that is flat or planar and has straight sides. It lacks crinkled sides. The edges of a polygon are also referred to as its sides.

Describe polygons with an example.

Any two-dimensional form that can be made entirely of straight lines is referred to be a polygon. Polygons include forms like triangles, hexagons, pentagons, and quadrilaterals. The name of the shape has a side count indication.

To know more about polygon visit:-

https://brainly.com/question/28276384

#SPJ1

HELPP PLS PLSSSSSS, LOOK AT IMAGE!!!!!!!!!!!

Answers

Answer: 1/3

Step-by-step explanation:

From the dice numbers only 1 and 2 are factors of 14

P(factor of 14)=2/6= 1/3

Answer:

A factor of 4 can only be 4 itself, which is one of the possible outcomes of rolling a 6-sided dice.

Therefore, the probability of getting a factor of 4 when rolling a 6-sided dice is:

P(getting factor of 4) = 1/6

This can be written as a fraction in the form of 1/n, where n is the total number of possible outcomes (6):

P(getting factor of 4) = 1/6

Step-by-step explanation:

i think i did a mistale and extremely confused and restless thinking that , what shall i do?

my sn ap = m_oonlight781

also i can help your homework on there so pls add me

What is 4/7-2/5

Pls answer

Answers

Answer:6/35

Step-by-step explanation:

Answer:

6/35or 0.1714285714

Step-by-step explanation

Covert to same denominator of 35. This will equal 20/35-14/35 which is 6/35 or 0.1714285714

Need an answer ASAP!

Answers

Answer:

74%

Step-by-step explanation:

$1983.20/ $2680 ×100= 74

=74%

Answer:26%

Step-by-step explanation:

yo bro need help with assigments

Answers

The boy needs to score 24 points in his fourth game so he could get the average of 24 points per game
the answer to this problem is 24!

(Order of Operations MC) HELP!!!!!!!!!!!

Jalissa's mom purchased coffee from the local coffee shop. The first cup of coffee was $3.95. Each refill is $1.25. She also decided to get a bagel for $2.50. If Jalissa's mom had 2 refills and a $0.50 discount as part of the rewards program, how much did she spend at the coffee shop?

$7.20
$7.45
$8.45
$9.45

Answers

Answer:

$8.45

Step-by-step explanation:

$1.25 + $1.25 =$2.50

$3.96 + $2.50 + $2.50 = $8.95

$8.95 - $ 0.50= $8.45

So that's how I got my and.

Jalissa's mom spent $8.45 at the coffee shop.

Steps:-

Add:

First cup of coffee. $3.95

Additional refill ($1.25×2). $2.50

Bagel. $2.50

Less: Discount. ($0.50)

Total Amount spent by

Jalissa's mom. $8.45

The probability of a spinner landing on 3 is 0.125, and the probability of landing on an even number is 0.5. Which spinner best models these probabilities? Responses

Answers

Because 0.125 is 1/8 and 0.5 is 1/2, it means the spinner must have 8 possibilities to land on

HELP!!! LOOK AT IMAGE!! PLEASEEEE HURRY

Answers

Answer:

Step-by-step explanation:

100%

all 3 can be divided into 36

Answer: 100%

Step-by-step explanation:

Because we know 1,2,3 can all go into 36 (36 is able to be divided by 1,2,3) and we want the percentage of the divisor of 36. We can determine that it would be 100% Since whatever card we pick, can be divided into 36. Sorry if that made no sense, I'm not the best at explaining this.

.............................................

Answers

12 Popsicles I think I'm not sure

four popsicles is the answer!!

The names of the months of the year
were written on separate papers and
placed in a hat. Two papers are ran-
domly drawn one at a time, replacing
the first before the second draw. What
is the probability of drawing. ?
(a) April and then June
(b) a month ending in r and then a
month ending in y
(c) May and then not drawing May


Write the probability as a reduced fraction

Answers

Step-by-step explanation:

There are 12 months of the year, so there are 12 possible choices for each draw. Since the first paper is replaced before the second draw, each draw can be considered as independent and with replacement.

(a) To draw April and then June, we need to draw April on the first draw (with probability 1/12), and then June on the second draw (with probability 1/12). The probability of both events happening is the product of their probabilities:

P(April and then June) = (1/12) x (1/12) = 1/144

(b) To draw a month ending in r and then a month ending in y, we can choose from the following months: April, June, July, September, and November. There are 5 months that end in r, so the probability of drawing one of them on the first draw is 5/12. After replacing the first paper, there are still 12 months left in the hat, but now we want to draw a month ending in y. There are 4 months that end in y, so the probability of drawing one of them on the second draw is 4/12. Again, the probability of both events happening is the product of their probabilities:

P(month ending in r and then month ending in y) = (5/12) x (4/12) = 5/36

(c) To draw May on the first draw and not draw May on the second draw, the probability of drawing May on the first draw is 1/12, and the probability of not drawing May on the second draw is 11/12 (since there are 11 months left in the hat after May is drawn on the first draw). Again, the probability of both events happening is the product of their probabilities:

P(May and then not drawing May) = (1/12) x (11/12) = 11/144

Therefore, the probabilities are:

(a) 1/144

(b) 5/36

(c) 11/144

Step-by-step explanation:

There are 12 months of the year, so there are 12 possible choices for each draw. Since the first paper is replaced before the second draw, each draw can be considered as independent and with replacement.

(a) To draw April and then June, we need to draw April on the first draw (with probability 1/12), and then June on the second draw (with probability 1/12). The probability of both events happening is the product of their probabilities:

P(April and then June) = (1/12) x (1/12) = 1/144

(b) To draw a month ending in r and then a month ending in y, we can choose from the following months: April, June, July, September, and November. There are 5 months that end in r, so the probability of drawing one of them on the first draw is 5/12. After replacing the first paper, there are still 12 months left in the hat, but now we want to draw a month ending in y. There are 4 months that end in y, so the probability of drawing one of them on the second draw is 4/12. Again, the probability of both events happening is the product of their probabilities:

P(month ending in r and then month ending in y) = (5/12) x (4/12) = 5/36

(c) To draw May on the first draw and not draw May on the second draw, the probability of drawing May on the first draw is 1/12, and the probability of not drawing May on the second draw is 11/12 (since there are 11 months left in the hat after May is drawn on the first draw). Again, the probability of both events happening is the product of their probabilities:

P(May and then not drawing May) = (1/12) x (11/12) = 11/144

Therefore, the probabilities are:

(a) 1/144

(b) 5/36

(c) 11/144

5. A number cube with the numbers 1-6
on its sides is rolled twice. What is the
probability of rolling ________
(a) a 1 and then a 6
(b) an even number and then an odd
number
(c) a number less than 3 and then a
number greater than 3


Write the probability as a reduced fraction

Answers

Answer:

Part - A = 1/36

Part - B = 1/4

Part - C = 1/6

Step-by-step explanation (Part - A):

The numbers on the cube are, 1 , 2 , 3 , 4 , 5 and 6.

Formula to calculate probability =
Total Number of the particular number / Total Number of Numbers

The probability of rolling 1 is 1/6 as there is only one 1 in a numbered cube.

The probability of rolling 6 is 1/6 as there is only one 6 in a numbered cube.

So, the probability of rolling 1 and 6 is 1/6 * 1/6.

The probability of rolling 1 and 6 = 1/36.


Step-by-step explanation (Part - B):

The numbers on the cube are, 1 , 2 , 3 , 4 , 5 and 6.

Formula to calculate probability =
Total Number of the particular number / Total Number of Numbers

The probability of rolling an even number is 3/6 = 1/2 because there are 3 even numbers in a numbered cube.

The probability of rolling an odd number is 3/6 = 1/2 because there are 3 odd numbers in a numbered cube.

So, the probability of rolling an even and an odd number is 3/6 * 3/6 = 1/2 * 1/2.

The probability of rolling an even and an odd number = 9/36 = 1/4.


Step-by-step explanation (Part - C):

The numbers on the cube are, 1 , 2 , 3 , 4 , 5 and 6.

Formula to calculate probability =
Total Number of the particular number / Total Number of Numbers

The probability of rolling a number that is less than 3 is 2/6 = 1/3 because there are 2 numbers that are less than 3 in a numbered cube.

The probability of rolling a number that is greater than 3 is 3/6 = 1/2 because there are 3 numbers that are greater than 3 in a numbered cube.

So, the probability of rolling a number that is less than 3 and a number that is greater than 3 is 2/6 * 3/6 = 1/3 * 1/2.

The probability of rolling a number that is less than 3 and a number that is greater than 3 is 6/36 = 1/6.


Hope my answer helps you.

:)

Please mark my answer as the BRAINLIEST. Plssssssssssssssssssss

Answer:

pls mark "harendraganesh" as brainlist that was the best answer I have ever seen

PLS HELP RIGHT NOW, IT'S URGENT

Answers

I HAVE NO CLUE SO SORRY
15-b=7

irdk is there any more info?

Need an answer ASAP!!!

Answers

Answer:

C) 25%

Step-by-step explanation:

68.75 - 51.56 = 17.19

17.19 / 68.75 = .2500 estimated

0.2500 x 100 = 25.00%

25%

What is the volume of this object? Enter answer as a mixed number.

u3

Answers

Answer:

31 1/4 units

Step-by-step explanation:

The equation for volume of a rectangular prism is length x width x height.

We know the length of the width and height are given as 2 1/2 u.

In this case we can simply find the height by counting the amount of blocks high it is, which in this case is 5.

Then we multiply the numbers together.

2 1/2 x 2 1/2 x 5 = 31 1/4

FIRST ANSWER=BRAINLIEST ANSWER :))

Answers

First answer: 12, second answer: 16
35^2 + b^2 = 37^2
1225 + b^2 = 1406
b^2 = 144
b = 12
12 + 4 = 16

HELP ME WITH THESE LAST 3 PLEASE
number each with answer
Thank you so much for people who helped me with my work because I really need it I’m behind

Answers

Answer:

Step-by-step explanation:

First image:

.0000625  m/s

.0003125 m

Second image:

1080

4320

Third

2240 g

Answer: First image:.0000625  m/s.0003125 mSecond image:10804320Third2240 g

Step-by-step explanation:

8th grade math i mark as brainliest

Answers

Answer: 1/16

Step-by-step explanation:

Answer: 1/16

Step-by-step explanation:

probability of 4

P(4)=1/4

probability of 6

P(6)=1/4

Because there is an "and" in the question and not an or you mulitiply the 2 probabilities

P(4 and 6)=(1/4)(1/4 = 1/16

find an equation that models the path of a satelite if its path is a hyperbola, a=45,000 km, and c= 71,000 km. assume that the center of the hyperbola is the origin and the transverse axis is horizontal.
Please show your work so i can understand!!

Answers

so first off, we know the hyperbola has a horizontal traverse axis, so that means equation wise, the positive fraction is the one with the "x" variable on it, center is the origin, meaning (h,k) is just (0,0), and we know the value for the distances "a" and "c", let's find "b".

[tex]\textit{hyperbola, horizontal traverse axis } \\\\ \cfrac{(x- h)^2}{ a^2}-\cfrac{(y- k)^2}{ b^2}=1 \qquad \begin{cases} center\ ( h, k)\\ vertices\ ( h\pm a, k)\\ c=\textit{distance from}\\ \qquad \textit{center to foci}\\ \qquad \sqrt{ a ^2 + b ^2} \end{cases} \\\\[-0.35em] ~\dotfill\\\\ \begin{cases} h=0\\ k=0\\ c=71000\\ a=45000 \end{cases}\implies \cfrac{(x- 0)^2}{ 45000^2}-\cfrac{(y- 0)^2}{ b^2}=1 \\\\[-0.35em] ~\dotfill[/tex]

[tex]\stackrel{c}{71000}=\sqrt{\underset{ a }{45000^2}+b^2}\implies 71000^2=45000^2+b^2 \\\\\\ 71000^2-45000^2=b^2\implies \sqrt{71000^2-45000^2}=b\implies 54918.12\approx b \\\\[-0.35em] ~\dotfill\\\\ \cfrac{(x- 0)^2}{ 45000^2}-\cfrac{(y- 0)^2}{ 54918.12^2}=1\implies {\Large \begin{array}{llll} \cfrac{x^2}{ 45000^2}-\cfrac{y^2}{ 54918.12^2}=1 \end{array}}[/tex]

Answer:16000

Step-by-step explanation:

b

Other Questions
(conservation of mass) for a certain incompressible flow field it is suggested that the velocity components are given by the equations is this a physically possible flow field? Please help me with this (9/4x+6)-(-5/4x-24) A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 55 C. If an RNA duplex oligonucleotide of identical sequence, substituting U for T, is constructed, how will its melting temperature compare to that of its DNA counterpart? - The tm will be higher. - The effect on tm of replacing U for T cannot be predicted. - The tm will be lower. - The tm will be unchanged. The time it takes a mechanic to change the oil in a car is exponentially distributed with a mean of 5 minutes. (Please show work)a. What is the probability density function for the time it takes to change the oil?b. What is the probability that it will take a mechanic less than 6 minutes to change the oil?c. What is the probability that it will take a mechanic between 3 and 5 minutes to change the oil?d. What is the variance of the time it takes to change the oil? Which of the following statements is the best description of the per capita generation of solid waste between 1960 and 2010?ANSWER:a.Between 1960 and 2010, per capita generation was relatively constant.b.Between 1960 and 2010, per capita generation of solid waste increased steadily.c.Between 1960 and 2000, per capita generation increased.After 2000, per capita generation declined.d.Between 1960 and 1990, per capita generation increased at a steady rate. After 1990, per capita generation continued to increase, but at a slower rate. find the running time equation of this program: def prob6(l): if len(l) Parts of a watershed Reconsider the Fingroup Fund in the previous problem. If during the year the portfolio manager sells all of the holdings of stock D and replaces it with 200,000 shares of stock E at S50 per share and 200,000 shares of stock F at $25 per share, what is the portfolio turnover rate? Well-designed performance evaluation systems accomplish many goals. Consider the following actions and state which goal is being achieved by the action a. Comparing targets to actual resuits b. Providing subunit managers with performance targets c. Comparing actual results with industry standards d. Providing bonuses to subunit managers who achieve performance targets Communicating expectations Motivating segment managers Promoting goal congruence and coordination Providing foedback e. Aligning subunit performance targets with company strategyf. Comparing actual results of competitorsg. Taking corrective actions h. Using the adage "you get what you measure" when designing the performance evaluation system Choose from any drop-down list and then continue to the next question. consider the following differential equation to be solved by the method of undetermined coefficients. y(4) 2y y = (x 4)2 Rob and Ashley are riding their bicycles uphill. Currently, Rob is 5.7 km from the top and climbing at 0.24 km/min. Ashley is 4.5 km from the top and riding at 0.17 km/min. Estimate when Rob will be closer to the top than Ashley mong the following pairs of sets, identify the ones that are equal. (Check all that apply.) Check All That Apply (1,3, 3, 3, 5, 5, 5, 5, 5}, {5, 3, 1} {{1} }, {1, [1] ) 0.{0} [1, 2], [[1], [2]) Find the missing dimension of the parallelogram. As reported by the Department of Agriculture in Crop Production, the mean yield of oats for U.S. farms is 58.4 bushels per acre. A farmer wants to estimate his mean yield using an organic method. He uses the method on a random sample of 25 1-acre plots and obtained a mean of 61.49 and a standard deviation of 3.754 bushels. Assume yield is normally distributed.Refer to problem 2. Assume now that the standard deviation is a population standard deviation.a. Find a 99% CI for the mean yield per acre, :, that this farmer will get on his land with the organic method.b. Find the sample size required to have a margin of error of 1 bushel and a 99% confidence level? The mean of the following incomplete information is 16. 2 find the missing frequencies. Class Intervals10-12 12-14 14-1616-1818-20 20-22 22-24 TOTALFrequencies 5 ? 10 ? 9 3 2 50 CONCEPTUAL FRAME WORK Which of the following statements are TRUE? Select all that are true. A. The t distribution gets closer to the standard normal distribution as the degrees of freedom increase. B. We use the t distribution in confidence intervals for the population mean when the population variance is known. C. The standard normal distribution has less area in the tails than the t distribution. D. Very large values (bigger than 4, say) are more likely under the z distribution than the t distribution. E. The mean of the t distribution is greater than that of the standard normal. F. The variance of the t distribution is greater than that of the standard normal. steam enters a 1.6 cm diameter pipe at 80 bar and 500 c with a velocity of 150 m/s. Determine the mass flow rate, in kg/s. The data values needed for this problem are attached below. PLEASE SHOW ALL WORK!! determine the impulse needed to increase the cars speed from 30 m/s to 35 m/sa. -75,000 kgm/sb. 75,000 kgm/sc. 10,000 kgm/sd. 5,000 kgm/se. none of the above Look up the pH of lemon juice and vinegar. Based on your results of there being little to no growth on the bread and apple with lemon and vinegar present and your knowledge of favorable environmental conditions for fungal growth, what can you conclude about the effect of pH on growth? How would making the pH more basic affect growth?"