Define [tex] \underline\mathbb{\pink{FIAT}}[/tex] Money.​

Answers

Answer 1

Answer:

Fiat money is a government-issued currency that is not backed by a physical commodity, such as gold or silver, but rather by the government that issued it. The value of fiat money is derived from the relationship between supply and demand and the stability of the issuing government, rather than the worth of a commodity backing it. Most modern paper currencies are fiat currencies, including the U.S. dollar, the euro, and other major global currencies.

Explanation:

hope it helps you

Answer 2

Answer:

hey how are you doing?

Explanation:

A fiat money is a type of currency that is declared legal tender by a government but has no intrinsic or fixed value and is not backed by any tangible asset, such as gold or silver.This includes the U.S. dollar, the British pound, the Indian rupee, and the euro.

Related Questions

Capital of Pakistan, India, Afghanistan and Iran

Answers

Answer:

Explanation:

1. Islamabad

2. Delhi

3. Kabul

4. Tehran

Which of the following is the correct definition for habitat?

Answers

Habitat- the natural home or environment of an animal, plant, or other organism.

21521120 que significa?

Answers

Según la información, se puede inferir que ese número significa veintiún millones quinientos veintiún mil ciento veinte.

¿Cómo leer un número?

Para leer un número de varias cifras debemos emplear el siguiente método, debemos separar el número por:

unidadesdecenascentenasunidades de mil.decenas de mil.centenas de mil.unidades de millón.decenas de millón.

De acuerdo a lo anterior, podemos inferir que la forma correcta de leer ese número es:

21'521.120 = veintiún millones, quinientos veintiún mil, ciento veinte.

Aprenda más sobre números en: https://brainly.com/question/21328200

#SPJ1

किसी पुस्तक विक्रेता को पत्र लिखकर पुस्तकें मँगवाइए । -​

Answers

Answer:

को,

दुकान प्रबंधक,

विमल बुक स्टोर

गया (बिहार)।

दिनांक: 1 मार्च 23

से,

जौहर

पटना (बिहार)

विषय: पुस्तकों के लिए ऑर्डर प्लेसमेंट

प्रिय महोदय/महोदया,

यह आपके ध्यान में लाना है कि मैं जौहर खान हूं और मैं पटना रहता हूं। मैं आरएस अग्रवाल के लिए एक आदेश देना चाहता हूं। मैं ऑनलाइन भुगतान के माध्यम से भुगतान कर सकता हूं। कृपया मुझे बताएं कि आपके स्टोर में ये पुस्तकें उपलब्ध होने पर पुस्तकों की डिलीवरी कब और कैसे की जाएगी?

कृपया मुझे उल्लिखित पुस्तकों के बारे में जल्द से जल्द बताएं।

धन्यवाद,

आपका धन्यवाद

जौहर खान

77121213XX

Gumawa ng tula tungkol sa pananampalataya at paniniwala ng mga katutubong muslim at igorot (4 na taludtod)

Answers

Answer:

beh naliligaw ka yata Ng country

Children's understanding of print knowledge and phonological awareness are evident in their writing

Answers

Answer: True

Explanation:

Actually, I'm not so sure but I feel like it is correct. Sorry for not being much help.

The ________ provided inspiration for the Latin American Revolutions, and the ________ directly provided the opportunity. American and French Revolutions; Napoleonic Wars Napoleonic Wars and French Revolution; American Revolution Napoleonic Wars and American Revolution; French Revolution French Revolution; American Revolution

Answers

According to the above information, the event that inspired the Latin American revolutions was the French Revolution, while what provided the opportunity was the Napoleonic Wars.

What was the French Revolution?

The French revolution was one of the most important events in the history of mankind, it was an uprising against the French monarchy by the intellectuals and lower classes of society against King Louis XVI and the nobility because his bad government had brought France to a state of social misery.

The French revolution was also an opportunity for new forms of political thought to emerge, because the intellectuals of the time believed that the monarchical system should be replaced by a more participatory one such as democracy.

What relationship does the French Revolution have with the independence of Latin American countries?

The French Revolution served as an inspiration for Latin American intellectuals, because they were inspired by the ideas of a new system of government to rebel against the Spanish crown.

What relationship do the Napoleonic wars have with the independence of the Latin American countries?

The Napoleonic wars were important for the independence of the countries of Latin America because during the Napoleonic wars the French invaded Spain causing a weakening of the Spanish institutions that lost control over their colonies and this allowed the revolutionary armies to achieve independence.

Learn more about independence in: https://brainly.com/question/21145269

#SPJ1

Answer:

American and French Revolution; Napoleonic Wars.

Explanation:

Since the American and French Revolutions aimed for equality in government systems and freedom overall, it inspired the Latin American Revolution.

complete the sentences rosa use an cream on the cut of her fingers to keep germs out of it

Answers

Answer:

Rosa applied a cream to the tips of her fingers to help remove the germs and limit the chance of infection to the wound

ano ang kahulugan ng nakalasap

Answers

Answer:

(nakalasap)Nakatikim

Can you give me the answer :

" My alarm goes off in the morning.
I try to go back to sleep.
My dog’s barking wakes me up"
how can I use these three sentences with, " When, But"?

Answers

When My alarm goes off in the morning, I try to go back to sleep, but

My dog’s barking wakes me up

Place these steps to naturalization in order: a) citizenship test; b) oath ceremony; c) immigration interview

Answers

Answer:

1: immigration interview

2: citizenship test

3: oath ceremony

Answer:

The answer is C, A, B.

무ㅛㅐㅜㄷ ㅠㅐㄱㄷㅇ ㅑ 므 내 ㅑ 햇 ㄺㄷㄷ ㅔㅐㅑㅜㅅㄴ ㅐㅗ 뭉 내 ㅑ 애ㅜㅅ ㄱㄷㄱ데ㅐㄳㄷㅇ 좀ㅅ 1+1?
use translate if you can't tell what I said

Answers

Answer: 1+1=2

Explanation: basic math :)

Y'all this aint properly typed out in korean T0T

Cual sería el tono que la mujer utilizó en el caso 1, y cual sería en el caso 2

Answers

El tono utilizado por la primera mujer fue informal, mientras que el tono utilizado por la segunda mujer fue irónico.

¿Qué son los Tonos Literarios?

Los tonos literarios son aquellos que mediante la expresión de las palabras, sin importar su significado, se da a entender al receptor el verdadero sentido de la conversación.

En el primer caso, la mujer le agradece al panadero con una cara sonriente por su ayuda, con lo cual se identifica un tono informal que expresa familiaridad hacia esa persona.

En el segundo caso, ya que la mujer no pudo realizar el papeleo que necesitaba, y la persona que la atendió no fue de ayuda, le da las gracias, pero ya que dicha persona no la ayudó en nada, se nota que su tono es irónico.

Si quieres aprender un poco más sobre Español, puedes visitar el siguiente enlace: https://brainly.com/question/20614549

#SPJ1

Read the sentence:


My walk was aimless because I was not really going anywhere.


What does the suffix –less do to the root word aim?


Changes the meaning to "with dreams"

Changes the meaning to "with purpose"

Changes the meaning to "without dreams"

Changes the meaning to "without purpose"

Pls give the correct answer

Answers

the right one is without purpose

where or what is the best and easiest way to learn russian

Answers

Answer:

reading books with russian in it that have a translation

Explanation:

its how i learned Italian

Explanation: Ask your friends to contact their friends or siblings who know russian, and then make a deal for some lessons and assignments.

Clearly, we are on the threshold of yet another revolution. Human knowledge is doubling every ten years.

What is the meaning of the underlined term?

Answers

Answer:

change or transformation

Explanation:

Lain help please? i'll give brainliest!!

verb conj. person number voice tense translation
cedunt 3 3rd p active present (they) yield
curant
neglegunt
eligent
discimus
pinxit
docet
discetis
docebunt
neglexerunt
pingit

Answers

Ya elegant sounds good to be on top to look up too much

What’s the main idea of Ice Capades in Antártica

Answers

Answer:

The main idea of ​​the article is to review Rachel's trip to Antarctica and reflect on caring for the environment.

Explanation:

PLEASE HELP !!!!
What is the effect of the narrator's point of view about the mission?


The narrator understands that he cannot complete the mission without help from his team members.

The narrator is not the only one on the team who worries about completing the mission.


The narrator knows that this rescue mission is one of many that he will perform in his career.


The narrator understands that doing his job well is crucial in life-and-death situations.

Rescue Mission- Read the passage.

Answers

The effect of the narrator's point of view about the mision is that D. The narrator understands that doing his job well is crucial in life-and-death situations.

What is a point of view?

This is known as a vantage point from which a story is presented.

Hence, we can se that in the complete text, the narrator is heard in the lines of the text saying "Every move will be deliberate and meticulous, just like that rescue from sophomore year. I’m close enough to see the relief in the fishermen’s faces. I’ve got this"

This goes on to explain why the narrator understands that doing his job well is crucuial and this affected the narrator's point of view about the mission.

Read more about point of view here:

https://brainly.com/question/647014

#SPJ1

चिड़िया किसका दिल टटोलती है ?
(a) वन (b) नदी( c) food

Answers

Answer:

वन इसका उत्तर हो सकता हैं

Which word are clues to the meaning of the word so consume

Answers

Answer:

To take in as food; eat or drink up. synonym: eat.

Explanation:

How should a reader analyze indirect characterization? Select four options.

by noticing adjectives that provide details describing the character
by noticing how the character interacts with other characters
by noticing details about what the character says, does, and thinks
by noticing how the other characters perceive the character
by noticing the context, and use it to make inferences about the character
by noticing statements the narrator makes about the character’s personality
by noticing statements the narrator makes about the character’s appearance

Answers

Characterization is analyzed by noticing interaction between characters, the perception other characters have and by making inferences using the context.

What is indirect characterization?

This refers to the way a character is defined by other means different from the narrator's direct descriptions.

How to analyze indirect characterization?Analyze how is the interaction between the specific character and others.Analyze what other characters think about him/her.Use the context to understand the character.Analyze his/her actions, words and thought.

Learn more about characterization in: https://brainly.com/question/660820

#SPJ1

Answer:

by noticing how the character interacts with other characters

by noticing details about what the character says, does, and thinks

by noticing how the other characters perceive the character

by noticing the context, and use it to make inferences about the character

Explanation:

Edge

In this passage, the words “ ample” and “plump” are

Answers

Answer:

B SENSORY IMAGES THAT DESCRIBE A MOTHERLY FIGURE

Explanation:

n this excerpt the woman that is described looks like a maternal figure and actually her look is described as “maternal interest”, even when the words “ample” and “plump” are used to describe a fat person in this case reflects the warm image of the woman, the answer is B sensory images that describe a motherly figure.

Culture shock is the fear or anxiety people feel when encountering cultures that are unfamiliar.

Answers

Answer:

and if also refers to feelings of uncertainty, confusion, or anxiety that people may experience when moving to a new country or experiencing a new culture or surroundings

Explanation:

Answer:

True

Explanation:

took test got 100%

ساعدوني. لغة العربية. اشرحولي

Answers

Answer:

رفع فعل المضارع الآخر في صيغة النصب والصحيح أمثلة. كان يسأل نفسه أسئلة سأدرس شيئًا عن حياة المحار فكر في ترك وظيفته لن تنجح في الصناعة والتجارة لم يجد لها إجابة لكنهم لم ييأسوا قبل أن يتم القبض عليهم القاعدة: الحالات التصريفية للفعل المضارع هي حالة نصب ، وجازمة ، ورسمية. علامات تحليل الفعل المضارع هي إيما في الحالة الاسمية ، والفتحة في حالة النصب ، والسكون في حالة الإيجاب.

When considering local issues, which point of view is best?

Answers

Answer:

in my opinion, I think for me I would have the people there tell me what they thought could be fixed or the problems they were having do I could better assess the situation.

Explanation:

this is my answer.

Alguien sabe la descomposición griega de arte, historia ?

Answers

Answer:

"Arte" es del latín "ars", y es el equivalente al término griego τέχνη (téchne, de donde proviene ‘técnica’).

De su origen se aplica a todo lo que es producido o realizado por el hombre y a las disciplinas del saber hacer.

Read these lines from Robert Frost’s "The Road Not Taken.”

And sorry I could not travel both
And be one traveler, long I stood

Which idea is conveyed by this part of the extended metaphor that is created throughout the poem?

The speaker desired to always be traveling.
The speaker desired to always travel alone.
The speaker could only travel to one place.
The speaker could only make one choice.

Answers

Answer:

PLEASE BRIANLY ME

Explanation:

The answer is D

Read the sentence:

You won't get no smarter if you don't study.

Select the grammatically correct revision with the same meaning.

If you don't study, you won't get no smarter.
If you study, you won't get smarter.
You won't get any smarter if you don't study.
You will get no smarter if you study.

Answers

Answer:

you won't get any smarter if you don't study

Explanation:

this makes more sense since all the other options use incorrect grammer or dont have the same meaning

____ is casual, naturally flows, and involves shared knowledge

Answers

According to the context of the sentence, it can be inferred that the term that correctly completes the sentence is "conversation".

What is a conversation?

A conversation is a term to refer to a communicative activity between two or more people who take turns in the role of sender and receiver to transmit messages.

Conversations can have various characteristics such as:

They can be casual or planned.They can be formal or informal.They can use words or signs.They can be in different languages.They can deal with different topics.

According to the above, it can be concluded that conversations can be casual, flow naturally and involve knowledge.

Learn more about conversation in: https://brainly.com/question/13266623

#SPJ1

Other Questions
Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1) Read the excerpt from Brown v. Board of Education.Therefore, we hold that the plaintiffs and others similarly situated for whom the actions have been broughtare, by reason of the segregation complained of, deprived of the equal protection of the laws guaranteed bythe Fourteenth Amendment.Why does the Supreme Court conclude that the plaintiffs have been denied their rights?O The plaintiffs' schools have neglected their responsibilities.O The Fourteenth Amendment fails to reference education.Segregation is inherently unequal and unfair.The plaintiffs' children have endured racial stereotyping.