The amphipathic nature of the phospholipid leads to the formation of the phospholipid bilayer organization because the phospholipid molecules contain both hydrophilic and hydrophobic properties.
Phospholipids' amphipathic nature means that their molecules have both hydrophilic and hydrophobic characteristics. The fatty-acyl tail of the phospholipid is non-polar in nature, but the head group of the phospholipid is polar.
Thus, this property of phospholipids caused the arrangement of the phospholipid bilayer of the plasma membrane, where the non-polar fatty-acyl tail is buried inside the hydrophobic interior of the bilayer, which is away from the aqueous phase, and the polar head groups face the cytosolic and extracellular faces, which are exposed to the aqueous medium.
Similar to how lipophilic molecules may easily penetrate the cell membrane, polar drugs must be changed in order for them to do so since they cannot do so in the polarized condition.
To learn more about Phospholipids visit: https://brainly.com/question/25616353
#SPJ1
In addition to seeds, which of the following characteristics is unique to the seed-producing plants?
A) sporopollenin
B) lignin present in cell walls
C) pollen
D) use of air currents as a dispersal agent
E) megaphylls
1. Which of the following statements about rock and mineral resources is true?
Choose all that apply.
a. There are no valuable minerals in Antarctica.
b. Rock and mineral resources are distributed evenly across the globe.
20. Exc. Rock and mineral resources are distributed randomly across the globe.
d. Most of the deposits shown on the Figure 4 resource map were used by prehistoric
people.
Vloga jert is e
are. The cost of extracting valuable minerals is the same everywhere in the world.
f. The value of a rock and mineral deposit depends on its size, shape, location, and
concentration.
Answer:
C Rock and mineral resources are distributed randomly across the globe is the answer
If the female is a carrier for the x-linked trait for colorblindness, and the male is colorblind, what percentage of their daughters wilI be colorblind?
Answer: 50%
Explanation: I used Punnet squares and past answers.
considering I used past answers it has to be correct. (the past answers were from less than a week ago)
Which of the following statements about mutations is false?
a. Addition and deletion mutations disrupt the primary structure of proteins.
b. An addition mutation results in an added base in the DNA sequence.
c. A deletion mutation results in the loss of a base in the DNA sequence.
d. A knock-out mutation results in a total absence of the mutated protein.
The false statement about mutations is: A knock-out mutation results in a total absence of the mutated protein.
Altering the genome's nucleic acid sequence of an organism, virus, or extrachromosomal DNA is known as a mutation.
Knock-out mutation refers to a DNA change that completely halts a gene's expression. In all types of cells and creatures, this is achievable using certain genetic techniques. CRISPR genome editing is currently the quickest and most direct method for accomplishing precise gene knockdown.
To learn more about Knock-out mutation click here,
https://brainly.com/question/29361996
#SPJ4
Match
Term
Polygenic
Chromosome
Allele
Codominant
Definition
A) one of two alternate forms of a gene
B) a threadlike structure of nucleic acids that carry genetic information
C) a relationship between two versions of a gene in which both variations equally
impact the expression of the trait
D) multiple genes that control one trait
The correct natch of the terms and the definitions are:
Polygenic - D) multiple genes that control one trait.Chromosome - B) a threadlike structure of nucleic acids that carry genetic information.Allele - A) one of two alternate forms of a gene.Codominant - C) a relationship between two versions of a gene in which both variations equally impact the expression of the trait.What is codominance?Codominance is a phenomenon in genetics where two alleles (different forms of the same gene) express themselves equally in an organism. As a result, characteristics linked to each allele are shown at the same time.
One common characteristic of people that you can't really see just by looking at them, but that many people are aware of, is their blood type. One A allele and one B allele are present in individuals with the blood type AB. Their blood type is AB because both alleles are expressed simultaneously.
Therefore, the correct option is
Polygenic - D) Chromosome - B) Allele - A)Codominant - C)To learn more about codominance, refer to the link:
https://brainly.com/question/14053639
#SPJ2
The circulatory system delivers hormones released by the ______________________ system to the body.
The person who gets it correct get brainly
A previous study claims that 75% of all students graduate
on time. You believe the percentage is lower than that.
Which of the following would be the hypotheses?
When the hypothesis is tested, it is discovered that there is insufficient evidence to draw the conclusion that the percentage is less than 75% because the test's p-value is 0.0957 > 0.05.
If the proportion is 75%, it is tested at the null hypothesis, which is:
200 is the sample size.
Positive result, x = 142
Sample proportion, 0.71; p = x/n
a = 0.05
Alternative and Null Hypothesis
H1: p 0.75 (the proportion of students who graduate on time overall is less than 75%).
testing data:
Z = (p-p)/(p*(1-p)/n) = (0.71/0.75)/(0.75*0.25/200) = -1.3064
p-value:
NORM.S.DIST(-1.3064, 1) = 0.0957, p-value (Using Excel Function)
Decision:
p value >, not proving the null hypothesis
Conclusion:
There is insufficient evidence to claim that less than 75% of students graduate on time.
To know more about Null hypothesis visit:
https://brainly.com/question/13949450
#SPJ1
Are viruses prokaryotic?
Viruses are neither prokaryotic or eukaryotic.
Who are Prokaryotes?
Living things with only one cell lack an appropriate nucleus and other organelles.Examples include cyanobacteria, bacteria, and archaea.In prokaryotic cells, bacteria and archaea are present. They lack a nucleus that is contained within a membrane. Instead, it is kept in a floating nucleoid in the cytoplasm of the cell. Prokaryotic cells typically range in size from 0.1 to 5 m in diameter, making them smaller than eukaryotic cells on average. Although prokaryotes only have one cell, they can pair up or group together to form mats.Who are virus?
They are contagious organisms that reproduce within their hosts.They are neither alive nor dead.Because they depend on the host cell to perform their fundamental tasks, they are not alive (replication, transcription, translation).Typically, they lack a cell wall. DNA and RNA serve as the genetic material inside the capsid, which is a protective protein shell.Adenovirus, Hepatitis C virus, and other examples.Due to the lack of life, they are neither prokaryotes nor eukaryotes. They are unable to live and reproduce on their own.Hence viruses are not prokaryotes
To learn more about prokaryotes click on the link
https://brainly.com/question/5716507
#SPJ4
Write a paragraph discussing the organs and substances involved in mechanical and chemical digestion.
Answer:
In the Digestive tract, the mouth is first on the list. This is where Mechanical digestion takes place. Teeth crush, grind, break, shred, and mash food into small pieces that are easy to swallow and digest. Saliva is an enzyme that starts to break carbohydrates if any. That's why the mouth also performs Chemical Digestion. Once the food is ready to be swallowed, it is pushed into the Pharynx and into the esophagus. The esophagus squeezes food with rhythmic muscle contractions-this is called Peristalsis. We have traveled in 3 out of the 8 organs in the digestive tract.
Explanation:
HELP ME PLEASE ILL GIVE BRAINLY
Answer:
1. Methionine, Glycine, Tyrosine, Isoleucine, Stop
2. 5, circle AUG, GGC, UAC, AUC, UGA
3. There will be 5 amino acids because we have 5 codons.
Explanation:
For this first question, we will need a codon chart, such as the picture I put up.
To find the amino acids with this, we will be using first, the first circle with the 4 big bold letters. for example we will use amino acid AUG.
Find A on the first circle. Then we will move down to the slightly less bold letters. find U.
Now, on the last set of letters, find G and the amino acid it is paired with. We got Methionine.
2. This will explain it probably, if not lmk and I'll go in depth.
A codon is any 3 letters (nucleotides) from either DNA or RNA that creates amino acids.
3. You need 3 codons to create 1 amino acid.
If we have 5 codons represented to us, we will as a result get 5 amino acids.
Hope this helped :)
PLEASE, PLEASE, PLEASEE!!!
EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY
The following lists components of the nature of science. Explain how at least two of these are related to the cell theory:
Scientific knowledge is durable yet subject to change
Science is a social activity.
x
Science is the process by which knowledge is created. Despite the fact that scientists reject the idea of discovering perfect truth and accept some uncertainty as a part of nature, the majority of scientific knowledge is enduring.
Cell theory is a biological theory first proposed in the mid-nineteenth century that states that living organisms are made up of cells, that cells are the basic structural/organizational unit of all organisms, and that all cells originate from pre-existing cells. The following are the basic tenets of cell theory: Every living thing is composed of one or more cells. All living things are made up of cells, which are structural and functional units. Cells are formed by the division of pre-existing cells. In terms of chemical composition, all cells are the same.
Theodor Schwann proposed the classical cell theory in 1839. This theory is divided into three parts. The first section asserts that all organisms are made up of cells. Other living cells produce all existing cells. Other living cells produce all existing cells. The cell is the most fundamental unit of life.
To learn more about cell theory, here
https://brainly.com/question/1468725
#SPJ1
How does a cell know when to divide, when to duplicate its chromosomes, or when to enter another stage of the cell cycle.
A cell knows when to divide when to duplicate its chromosomes, or when to enter another stage of the cell cycle by communicating with each other using chemical signals from special proteins called cyclins.
Cells control their division by exchanging chemical signals via unique proteins called cyclins with one another. These signals function as switches that inform cells when to begin dividing and then when to stop.
A cell has to go through a number of checkpoints in order to transition from one stage of its life cycle to the next. Specialized proteins inspect each checkpoint to see if the required circumstances are there. If so, the cell can move on to the following stage.
In order for each new cell to include all of the necessary genetic information, the genes must also produce copies of themselves prior to cell division.
To learn more about Cell visit: https://brainly.com/question/1303025
#SPJ1
What happens in the energy harvesting phase of glycolysis?
O Glucose is transformed into fructose diphosphate.
O Fructose diphosphate splits into two 3-carbon molecules.
O ATP molecules are broken down to ADP and a phosphate group.
O Glyceraldehyde 3-phosphate is converted into pyruvate.
The energy payoff phase of glycolysis consists of five additional steps and results in the formation of four ATP, two NADH + H+, and two pyruvate molecules. Substrate level phosphorylation is the process by which ATP is produced from the transfer of a phosphate group from a substrate molecule in a metabolic pathway.
Through a sequence of processes known as glycolysis, glucose is divided into two pyruvate molecules, each of which has three carbons. The vast majority of creatures on the planet today use glycolysis, which is an old metabolic route that originated long ago. 2,3 2,3 start superscript, 2, comma, 3, end superscript
Glycolysis is the initial step in the process of cellular respiration in organisms. However, many anaerobic organisms—organisms that do not use oxygen—also contain this route since glycolysis does not require oxygen.
To know more about glycolysis visit:
https://brainly.com/question/14076989
#SPJ9
Select all the correct answers.
The image shows a rain forest ecosystem. The energy from plants, or producers, acts as the starting point of energy in the ecosystem. This energy is transferred to other organisms in the food web. In which two ways is the total amount of energy conserved in the ecosystem?
The organisms get some energy, while the remaining energy is discharged as thermal energy into the ecosystem. In an ecosystem, as we proceed up the trophic levels, we notice that the amount of energy keeps decreasing.
This phenomenon happens as a result of an ecosystem's inefficient energy transfer from one trophic level to another. The majority of the energy is discharged into the atmosphere as heat. It is known that around 10% of the energy in an ecosystem moves from one trophic level to another.
Thus, we can state that while the organisms receive some energy, the remainder enters the ecosystem as thermal energy. The amount of energy in an ecosystem decreases as we move up the trophic levels, as can be seen.
LEARN MORE ABOUT THE ECOSYSTEM HERE:
https://brainly.com/question/13979184
#SPJ1
Your question is incomplete. Please find the complete question below.
Question: The image shows a rainforest ecosystem. The energy from plants, or producers, acts as the starting point of energy in the ecosystem. This energy is transferred to other organisms in the food web. In which two ways is the total amount of energy conserved in the ecosystem?
A. Some energy is transferred to the organisms, and the remaining energy is released into the ecosystem as thermal energy.
B. Bacteria eat the dead bodies of organisms to release the organisms’ stored energy into the atmosphere.
C. Some energy is transferred to the smaller organisms, and the rest is stored in the bodies of larger animals.
D. Some energy is transferred to the organisms, and the rest is released by plants in the form of carbon dioxide.
E. Bacteria eat the dead bodies of organisms, obtain all the energy, and store it in their bodies.
9. Is the condition in this pedigree inherited as a recessive or a dominant trait?
Answer: Recessive trait.
Explanation:
First generation:
In the first generation of the pedigree, the female is affected, while the male is not affected. Thus, the female must have at least one copy of the disease gene, while the male may or may not be a carrier.
Second generation:
They mate to give a normal female progeny. This female progeny has two X chromosomes, one from each parent. The female mates with a normal male and one of their sons are affected by the condition. This leads us to believe that the female was a carrier, and so was the male, and thus, the son has one affected gene from each parent, making him homozygous recessive for this condition.
Learn more about pedigrees:
https://brainly.in/question/2200837
https://brainly.in/question/6119272
Which is true of Gram-
positive bacteria?
A. a thin cell wall with little
peptidoglycan
B. causes E. coli and chlamydia
C. dyes purple with crystal violet and
iodine in its cell wall this
D. more threatening and difficult to
kill with antibiotics
Answer:
D
Explanation:
ti know its right because i have answred this question before
Answer:
c) dyes purple with crystal violet and iodine in its cell wall.
Explanation:
Gram-positive bacteria dyes purple with crystal violet and iodine in its cell wall. Hence, the option (c) is the correct answer.
Using the following genomic sequence:
1) Underline each intron
2) Circle each exon
UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG
AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU
GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA
CAUAAU
Intron are underlined and the Exon circled (in brackets)
(UUU)(AUG)(ACU)(AAU)(GAU)(GAA)UAA(UAU)(AUG)(AUG)(CGU)(AGU)(AAU)(CCU)(UCU)(GCA)(GAU)UAG
(AUA)(AUG)(UUU)(UUA)(CCC)(ACC)(AAC)(GAC)(GCC)(AUG)UGA(CGU)(CGA)(AUG)(ACU)(ACC)(AAU)(GCU)
(GCU)(GGA)(CUA)(ACA)UAA(UCG)(UAU)(GGA)(AGG)(GUG)(UCA)(AUG)(UUC)(UCC)(UAU)(GUA)(AUG)UAA
(CAU)(AAU)
What is genomic sequencing?The method used in the laboratory for determining the genetic make up of any organism or their cell type is called genomic sequencing. Genes are made up of introns and exons which are nucleotide sequences.
Introns are none coding sections of heterogeneous nuclear RNA and are removed by splicing as the RNA matures while exons are present in messenger RNA that encodes the amino acids of protein. Genes have various exons that bear introns linking them.
Learn more on genomic sequence here: https://brainly.com/question/29316113
#SPJ1
1. A. Describe the light reactions of photosynthesis, indicating how
photosystems I and II function to capture light energy and contribute tothe formation ATP and reducing power and indicating the source of
reductant, and products formed.
Answer: The process is reversed. Photosystem ll happens before photosystem l. I know that's weird but it's true. In photosystem ll which happens first it makes the energy carriers for ATP Synthase to happen in Photosystem l which is the next phase. Hope this helped!
Explanation:
Similar to the Galápagos finches, the Hawalian honeycreepers are a group of diverse
birds that are descended from a common ancestor. Over time, different adaptations
evolved for feeding and mating in their respective habitats. V Compare How does
common ancestry explain Loss's observations of anoles?
According to DNA sequencing data, lizards on each island are more closely related to one another than to similar species on other islands, implying that the same types of anoles evolved independently on different islands.
Divergent evolution refers to the process by which different organisms with common ancestors develop different traits or characteristics in order to adapt to changing environmental conditions and needs. It is also referred to as adaptive radiation. The Galapagos finch is a classic example of divergent evolution, as Darwin discovered that the finches' beaks adapted differently in different environments.
Convergent evolution occurs when species occupy similar ecological niches and respond to similar selective pressures in similar ways. Analogous structures are traits that emerge as a result of convergent evolution. They are distinguished from 'homologous structures,' which share a common origin. This is because anoles are a spectacular example of convergent evolution, in which different living things independently acquire the same adaptations to the same challenges.
To learn more about divergent and convergent evolution, here
https://brainly.com/question/3405872
#SPJ1
what is a good answer to ape theory
Which is the odd one out - ant, ostrich, prawn, snake, turtle
Answer:
Ostrich
Explanation:
Ant, prawn, snake and turtle are all poikilothermic (or cold-blooded) whereas ostrich is an endotherm (or warm-blooded) making it the odd one out.
The options given are cold blooded animals along with one odd option. The correct answer is ostrich.
What is the class of ostrich ?
Ostrich is the largest bird. It lays largest eggs and the ostrich are the birds that can not fly as they are very heavy in weight. It belongs to the class aves.
Ostrich is a bird that is poikilothermic in nature. Birds are poikilothermic that is warm blooded. Birds have the warm blood and these are able to maintain their warm temperature, these are ectothermic in nature. In case of reptiles and insects where the class reptilia and the class insecta are the species to which the remaining belong to.
The only different is that the ostrich is poikilothermic in nature that is it is warm blooded in nature. The other reptiles and insects are cold blooded that is endothermic in nature.
Learn more about poikilotherms at :
https://brainly.com/question/18566936
#SPJ2
All organisms use respiration, but?
Describe how you could make up the following glucose concentrations when given a 1% standard solution(there may be several different ways for each) A)0.02%. B)0.003%. C)0.0005%
0.02%. glucose concentrations when a 1% standard solution is administered.
How is 1% glucose solution made?By multiplying (mass/volume) by volume and keeping in mind that 1 g in 100 ml equals a 1 percent solution, you can determine how much glucose is required to form a solution of a certain percent. For this example, multiply (20/100) by 500 to create a total solution of 500 ml of 20 percent glucose.
What is 1% of a concentration?A 1% (w/w) concentration is created by combining 1 g of one substance with 100 g of another, such as 1% (w/w) salt in sand. Another vintage signifier of concentration that you could still come across (simply take a look at the side of the term "parts per million (ppm)" is used.
To know more about glucose concentrations visit:-
https://brainly.com/question/3499336
#SPJ1
Which of these examples involves a human body organ creating a force?
A The skin produces sweat on a hot day to help cool the body off.
B
C
The brain sending electrical impulses
The stomach releasing gastric acid to help break down food
D The heart pumping blood through the veins
Answer:
D
Explanation:
The heart is a muscle that physical contracts to force blood through the human body. I'm around 90% it is D.
¿What is the Medium?
¿What is the Medium?
it is the place inhabited by living beings, it can be terrestrial like the desert, forest, and it can also the desert, forest, and it can alsobe aquatic like lakes and oceans.
This is or Oceans
Hope this helped or you!
Directional terms I need help asap so baldy please
Directional terms for the numbered arrows are:
superior/cranialposterior/dorsaldistalanterior/ventralinferioranteriormediallaterallateralmedialWhat are directional terms?In anatomy, directional terms are used as a compass to describe where structures are located in relation to other parts of the body. It is a useful part of anatomy that provides basic communication and limits confusion.
These directions go together with body planes and are applied to these planes to describe regions and sections of the body with specificity. The directional terms are anterior, posterior, lateral, medial, distal, proximal, dorsal, inferior, superior, bilateral, deep, visceral, axial, caudal etc.
Learn more on directional terms here: https://brainly.com/question/24771456
#SPJ1
Explain what are two factors that determine the thermal energy of a substance
The factors that determine the thermal energy of a substance are temperature and mass, which are associated to the number of particles (mass) and kinetic energy (temperature).
What is thermal energy?The term thermal energy makes reference to a type of kinetic energy in which the particles are in constant movement, in the opposite way than potential energy which makes reference to the storage of energy such as occurs in the chemical bonds of foods.
This type of energy (thermal energy) is associated with the relative movement of particles in a substance, i.e. its temperature, as well as the mass which depends on the number of particles that form the substance.
Therefore, with this data, we can see that thermal energy depends on both the temperature or relative movement of particles and also the mass of a given object, which is represented by the number of particles per unit of area.
Learn more about thermal energy here:
https://brainly.com/question/19666326
#SPJ1
please help thanks
write an equation that represents the difference in seed yield between beans without treatment and beans with treatment
The equation (seed yield with treatments and seed yield without treatments) has a value of 340 and represents the difference in seed yield between beans with and without treatments.
microorganisms that fix nitrogen, indicating a novel way to increase yields, communicate with soybean roots. Soybean plants collaborate with a bacterium known as rhizobia, which can transform atmospheric nitrogen into organic forms the plant can use to receive the nitrogen they require.
The details which are available to us are the diagram that shows the seed yield.
The necessary equation to express the variation in seed yield between beans treated and untreated is as follows:
(Seed yield following treatment vs. seed yield in the absence of treatment)
[tex](300+310-270)= (610-270)= 340[/tex]
Therefore, the equation (seed yield with treatments-seed yield without treatments) will have a value of 340 and shows the difference in seed yield between beans with and without medicines.
LEARN MORE ABOUT NITROGEN-FIXING BACTERIA HERE:
https://brainly.com/question/7049583
#SPJ1
4. This fossil pterodactyl and this living elephant both have a bone in their hip called the ilium. What best explains why both species have an ilium?
Answer:
Explanation:
The pterodactyl and elephant both share the same ancestor population that had an ilium bone. They inherited this structure from the ancestor population. I hope this helps!
7. Which landform is the result of glacial erosion?
A. a horn
B. a moraine
C. an outwash plain
Answer:
i believe its A.horn
Explanation:
hope this helps ya;)