Dichotomy means_____.

A to cut into two parts
B two classifications
C to separate equally

Answers

Answer 1

Answer:

B

Explanation:

Dichotomy is a division or contrast between two things that are or are represented as being opposed or entirely different.


Related Questions

What is the relationship between population and demand for resources?
equal
There is no relationship.
inversely proportional
directly proportional

Answers

Answer: (directly proportional)

the reason is the because the meaning of directly proportional is one increasing & decreasing at different rates. when a population takes resources the population grows but the resources sink but not in the same rate unless it would be inversely proportional if the population was increasing and decreasing at the same exact time as the resources

Which ,begin emphasis,two,end emphasis, statements describe how constantly changing conditions affect the overall population size of organisms living in the area?

Answers

The correct options would be B and E.

Variation in population size

The population size of each organism in different zones may not vary much due to the following:

Organisms in each zone have characteristics that make them be well-adapted to the zone. These include structures that help them attach to the rock, structures that help them breathe when exposed to the air, and so on.

More on adaptations of organisms can be found here: https://brainly.com/question/1686177

#SPJ1

The backbone is also known as the vertebral column. Justify in accordance with both the
terms used

Answers

dont say babe lol is it bc i’m black no hehehe rawr im doing this so i can literally get answers for this thing

Which feature of the ocean floor includes its deepest parts?

Answers

Ocean Trenches also known as Deep Sea Trenches

how can global warming lead to changes to the Earth's surface?

Answers

Answer:

It could lead to the changes in the earths surface because it could open up geysers in the crater, causing the earths surface to change.

Explain why it makes sense that the levels of estrogen and progesterone are low in blood of a female during menstruation

I'll give brainly to whoever response is good !
please help me :C

Answers

Answer:

At the beginning of the follicular phase, the lining of the uterus (endometrium) is thick with fluids and nutrients designed to nourish an embryo. If no egg has been fertilized, estrogen and progesterone levels are low. As a result, the top layers of the endometrium are shed, and menstrual bleeding occurs.

You are provided with three liquids - Water, honey and oil. On pouring the three liquids simultaneously without disturbing. What will be the arrangement of these liquids from top to bottom and why? Conduct this experiment at home and paste the picture of it with proper labeling​

Answers

Answer:

Honey would be on the bottom, water in the middle, and oil on the top.

Explanation:

Honey is on the bottom because it has a is greater density than water, and oil is on the top because it has less density than water.

It all depends on the viscosity of the materials. Honey on the bottom, oil floating on top and in the middle is water.

What kind of liquids float on water ?

The liquids which are in lesser weight just floats over the surface of water.

In the attached image it can be seen clearly that the denser of all is honey which has the property of viscosity as well and it just settles down on the surface whereas the lighter of all is the oil which is seen floating on the surface.

Oil and Water  is usually the most common  type of example of the two  types of immiscible liquids.  In this no matter what quantity you mix  the oil and water in that  they do not mix up . The reason why  this happens is as of the basic  chemical nature of  the oil and  the water molecules.

Learn more about miscible liquids at :

https://brainly.com/question/2193479

#SPJ2

You are taking conductivity and salinity measurement in an estuary every half hour over a tidal cycle. Explain what a graph over time would look like for an upper estuary site where farmers use the water for irrigation and a lower estuary site where there is a bream and flathead fishing industry.

Answers

A graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

What are salinity and conductivity measurements?

Salinity is a measure of the salt content of a water body.

Conductivity is a measure of the electrical conductivity of a solution or substance.

Conductivity increases with increase in salinity.

An estuary is a region where salt water from the sea meet freshwater from a river or stream.

At an upper estuary site where farmers use the water for irrigation, there will be decreased salinity and conductivity with time, while at a lower estuary site where there is a bream and flathead fishing industry, their will be increased salinity and conductivity with time.

Therefore, a graph over time of salinity and conductivity at an upper estuary site will be less inclined than that at a lower estuary site.

Learn more about salinity and conductivity at: https://brainly.com/question/2472580

#SPJ1

List 5 things that cellular respiration and photosynthesis have in common.

Answers

Photosynthesis and cellular respiration are two biochemical processes that are essential to most life on Earth. Both of these processes involve multiple complex steps and many of the same molecules—oxygen (O2), carbon dioxide (CO2), water (H2O), glucose (C6H12O6), and adenosine triphosphate (ATP). im not sure but this?

Which of the following best explains how monkey is able to exchange gases with its environment and deliver oxygen throughout its body?

Answers

The ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.

What is respiratory system?

The respiratory system is defined as one of the body systems that are made up of a network of tissues and organs that aid in the exchange of carbon dioxide and oxygen.

The oxygen passes from the environment into the nostrils. It is then conveyed by the trachea to the bronchi and arrives at the alveoli where the oxygen is delivered to the body cells.

Therefore, the ability of a monkey to be able to exchange gases with its environment and deliver oxygen throughout its body is through the activities of the respiratory system.

Learn more about respiration here:

https://brainly.com/question/18169685

#SPJ1

Genetic drift and natural selection … (a: never lead to different populations - - that happens by another mechanism in nature , (b:can lead to new species that share common ancestor.

Answers

Answer:

B.) Can lead to new species that share common ancestors

Explanation:

Genetic drift and natural selection both lead to evolution. This describes the change of a species overtime to be better suited for their environments. In some cases, this leads to the creation of an entirely new species (speciation).

Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms?

Answers

The ease of identification of different organisms based on their characteristics is the reason why standardized taxonomic classification system is important.

What is Taxonomic classification system?

This is defined as the classification of organisms based on shared characteristics.

This makes it easier for scientists to group or determine the relatedness of the organisms in the ecosystem.

The complete question is:

Scientists use a standardized taxonomic system to separate organisms into hierarchical groups based on similarities and differences in their structural and genetic characteristics.

Which of the following best explains why a standardized classification system is important to the scientific community?

Read more about Taxonomic classification system here https://brainly.com/question/11724129

#SPJ1

The component molecules of cells have two main parts, the head and the tail. These parts are either hydrophobic or hydrophilic. Which is which

Answers

Fatty acid tails = hydrophobic
Phosphate heads= hydrophilic

10 points!

A fungal ____________ is a haploid reproductive cell that is capable of developing into a new organism.

Answers

Answer:

it’s a spore

Explanation:

it should be a spore. It’s because the spore is the haploid.

We can mold metals into different shapes because they are _____________.
ductile
malleable
lustrous

Answers

Answer:

We can mold metals into different shapes because they are _malleable__.

Explanation:

Malleable (ability to be hammered into thin sheets)

Punnett squares are used by geneticists to determine the probability of different offspring genotypes. In the one shown below, what letter(s) belong in the lower right box?

Answers

Answer: aa

Explanation:

    In a Punnett square, the lower right box will use the right letter on the top and the bottom letter along the left. This means we end up with: aa

   See attached for more.

Read more about Punnett squares here:

https://brainly.com/question/3665972


How might compound leaves and leaves with lobed margins be well-suited to windy environments?

Answers

Compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

What is a plant adaptation?

A plant adaptation is any type of trait that confers an evolutionary advantage in a given environment.

Plant adaptations include, for example, the presence of fewer stomata in leaves in plants living in arid conditions.

In conclusion, compound leaves and leaves with lobed margins can be suited to windy environments because they decrease air resistance, avoiding the loss of water by evaporation.

Learn more about plant adaptations here:

https://brainly.com/question/29594

#SPJ1

choose the correct answer​

Answers

number 2

number 2 because the colour doesnt matter

Which of the following is NOT approved for chemical sanitizing after washing and rinsing?
Quaternary ammonium
Chlorine
lodine
Detergent

Answers

the correct answer is detergent which is not approved

The chemical that is allowed for being used in hand sanitizing is quaternary ammonium, chlorine, and iodine. The one that is not included is detergent, i.e., option D.

What is a hand sanitizer?

Hand sanitizers are the solution made up of some chemicals including quaternary ammonium, chlorine, and iodine.

Detergents are not approved during the formation of hand sanitizer.

Thus, the correct option for the given scenario is D.

For more details regarding sanitization, visit:

https://brainly.com/question/4296165

#SPJ2

. Which describes the function of the cell cycle in such single-celled organisms?
reproduction
repair
growth
protection

Answers

A. Reproduction. Single celled organisms make copies of themselves through mitosis which describes the function of the cell cycle

What is meant by solar energy?

Answers

Answer: Solar energy is the radiation from the Sun capable of producing heat, causing chemical reactions, or generating electricity.

Explanation:

Answer:

Renewable energy produced by the sun. It is carbon neutral but unreliable.

Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence “ccgg”. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA

Answers

In Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

What are restriction enzymes?

Restriction enzymes are specific enzymes that cut nucleotide strands in particular sites (in this case, CCGG).

These enzymes (restriction enzymes) can be used to digest a DNA sample and then identify different species by electrophoresis.

In conclusion, in Species X, the segments will be ATTCCGG ATCGATCGCCGG, ATATACTCCGG and TAATATC (it is possible to repeat this process with another species).

Learn more about restriction enzymes here:

https://brainly.com/question/15278286

#SPJ1

An organism that is eaten by a predator is

Answers

Prey is a term given to the organism that is eaten by the predators.

Sebastian wants to make ball-and-stick models of the four macromolecules. He has colored balls for each of the elements in these molecules, including the following.

red: hydrogen
black: carbon
purple: oxygen
green: nitrogen

Which molecule could he make that consists of long chains of red and black colored balls?
carbohydrates
lipids
nucleic acids
proteins

Answers

Macromolecules are defined as large molecules like lipids, proteins, and carbohydrates.

In the given data, the red colour denotes hydrogen and black denotes carbon. The molecule that needs the majority of red and black color is carbohydrates.  Thus, option "A" is correct.

What are Carbohydrates?

Carbohydrates can be explained as:

Carbohydrates are the macromolecules, generally referred to as sugar. Carbohydrates are the primary nutrients of the diet along with proteins and fats.

Carbohydrate is a biomolecule that is made up of carbon, hydrogen, and oxygen atoms. The monomeric units of carbohydrates are monosaccharides.

Thus, the correct answer is Option A.

To know more about carbohydrates, refer to the following link:

brainly.com/question/16987478

#SPJ1

Thad rolls his bowling ball down the lane with a
force of 63 Newtons. If his ball has a mass of 7 kg,
what is the resulting acceleration of the ball?
35.

Answers

The acceleration of the ball is, 9m/s.

How, explain your answer briefly?

Given data:

The mass of the bowling ball is, m = 7 kg.

The magnitude of force offered by ball is, F = 63 N.

The above problem is based on the Newton's second law of motion. According to the Newton's Second law of motion, the applied force is equal to the product of mass and acceleration of the body.

So,

F = ma

Solving as,

a = F/m

a = 63/7

Thus, we can conclude that the acceleration of the ball is, 9m/s.

Learn more about Newton's second law here:

brainly.com/question/13447525

#SPJ1

Wild salmon spend most of their lives in the ocean but return to freshwater rivers to spawn, or reproduce. Most wild salmon will only spawn in specific spawning grounds in the rivers in which they were born. The construction of hydroelectric dams in rivers has blocked the paths of some salmon returning to their spawning grounds. This has led to population declines. Which method would be most effective in preventing further wild salmon population declines caused by the construction of hydroelectric dams?

A.
establishing protected regions around wild salmon spawning grounds in specific rivers
B.
observing the migration patterns of wild salmon by tagging and tracking a small sample of fish
C.
monitoring genetic diversity by using netting to catch salmon and obtain genetic samples
D.
constructing passageways next to dams to allow salmon to swim around blocked rivers

Answers

Constructing passageways near the dams to allow to salmon to swim around blocked rivers. Thus, option "D" is correct.

How, explain your answer briefly?

The construction of dams in rivers has blocked the path of  some salmons returning to spawning grounds.

The best way to overcome this is to make the passage ways near the dams to allow salmons to swim in areas which have blocked due to dams. So that salmons can returned to the spawning ground and can spawn which leads to increase in their population.

Thus, option "D" is correct.

To learn more about salmons click here:

https://brainly.com/question/16208604

#SPJ1

another name for the cell, or plasma, membrane

Answers

Another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).

What is the plasma membrane?

The plasma membrane is a physical barrier that separates the cell from its surrounding environment.

This barrier (plasma membrane) is fundamental to maintain the internal homeostasis state of the cell.

In conclusion, another name for the cell membrane or plasma membrane can be Plasmalemma (it is uncommon).

Learn more about the plasma membrane  here:

https://brainly.com/question/734740

#SPJ1

which phrese does not describe oceans near the equator

Answers

Low lightning does not describe oceans near the equator. thus option D is correct..Low tempretare, low salinty and low density are the other options which are not mention in question.

Which oceans are near the equator?

The Pacific, Atlantic, and Indian Oceans are all located along the equator.

Low lighting does not describe oceans near the water because they receive maximum sunlight in the daytime. As a result, the equator experiences significantly stronger sunshine than the north and south poles, which warms the water there.Low tempretare, low salinty and low density are phrase describe ocean near the equator.

Learn more about oceans near equator here:

https://brainly.com/question/25780353

#SPJ1

One possible reason for the rise in the average air temperature at the Earth's surface is that

Answers

Answer:

cimate change

Describe a trophic cascade (at
least three organisms long)
that would occur if the orca
whale population were to decrease

Answers

Answer:

escribe a trophic cascade (at

least three organisms long)

that would occur if the orca

whale population were to decrease

Explanation:

Other Questions
When drawing a supply curve, we always place on the vertical axis and supplied on the horizontal axis. (Use one word for each blank.) Students are attempting to make a doorbell ring using some wire and a battery. What is needed to make the bell ring? Can someone check if my answers are correct or wrong? thanks What is the value of x and y please explain will give brainliest if you give me a good explanation!! The angle measures of quadrilateral RSTU are shown.mR = (2x)mS = (3x 35)mT = (x + 35)The measure of angle U is unknown. Can quadrilateral RSTU be a parallelogram?Yes, opposite angles R and T are congruent to each other if x = 35.Yes, consecutive angles R and S are congruent to each other if x = 35.No, if x = 35, all three given angles measure 70. The fourth angle would measure 150. No, if x = 35, the three given angle measures make it impossible for the figure to be a quadrilateral. HELP WITH THE RIGHT ANSWER FOR BRAINLIEST!!! What is the volume of this rectangularpyramid?3 m4 mSubmit5 mcubic meters H. La cena - Fill in the blanks with the preterite of the verbs. (5 x 1 pt. each = 5 pts.)1. T / comer2. Gerardo / comprar3. Nosotros / ir4.Ustedes/pagar5. Carla y Toms / ser 9/12 devided by 2/12 Which rights were primarily controlled by Jim Crow laws?Question 3 options:A. press rightsB. free speech rightsC. voting rightsD. assembly rights A pulley system is used in an auto repair shop to lift a 200 kg engine block 1.5 m out of a car. The lower pulley is attached directly to the engine block, and there are 8 strands of rope attaching the lower pulley to the upper pulley. The repairman pulls through 12 m of rope in the process of lifting the engine block. How much work is done during this process societies make desisions about who gets the goods they produce by: which sentence uses the proper MLA style for an in-text citation with an attributive phrase ? (a) IN a recent study,titled Home Schooling Works,Dr. Lawrence Rundner(11) found that borneschoolers scoredhigher on standardized tests. (b) IN a recent study,titled Home Schooling Works,Dr. Lawrence Rundner found that borneschoolers scoredhigher on standardized tests(rudner,11). (c) IN a recent study,titled Home Schooling Works,Dr. Lawrence Rundner(2016) found that borneschoolers scoredhigher on standardized tests. (d) IN a recent study,titled Home Schooling Works,Dr. Lawrence Rundner found that borneschoolers scoredhigher on standardized tests (11). By percent, how much greater do sales of horror books appear to be than sales of cookbooks? how much greater are they in reality? a. there appear to be 50% more sales of horror books than cookbooks, but there are really only about 20% more. b. there appear to be 40% more sales of horror books than cookbooks, but there are really only about 5% more. c. there appear to be 20% more sales of horror books than cookbooks, but there are really only about 10% more. d. there appear to be 25% more sales of horror books than cookbooks, but there are really only about 2% more. During the editing process, Monique notices that many of the shots she took earlier in the week show people with odd skin tones. What likely caused this?1) the heavy compression applied to the color data in JPEG files2) the inability to capture background objects when shooting in RAW and JPEG simultaneously3) the incorrect time stamps due to an error in the cameras settings4) the inability of object sharpness to be captured when shooting in RAW Which of these was a primary reason chinese immigrants came to the united states in the early 1850s? Which symptom is characteristic of someone on a hallucinogenic drug?. it is recommended to start saving and investing as early as possible because it allow your money to 'work for you". What does this mean? which would be easier to prepare for, a tornado or an earthquake? To give a child the best chance at a healthy birth and infancy, a pregnant woman should do all of the following EXCEPTA. avoid second-hand smokeB. clean the house with strong chemicalsC. frequently wash hands and avoid illnessD. gain weight recommended by your doctor