DNA and RNA are the same thing.

True
False

Answers

Answer 1

Answer:

Start studying DNA and RNA (true or false). ... TestNew stuff! ... No two nucleotide sequences in DNA molecules are ever the same. false.

Explanation:


Related Questions

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

Answers

Answer: B

Explanation:

Answer:

I think A! Sorry if wrong!

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

Answers

The cas because they are not vegan and they are not good enough for me and I’m not like that what

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Answers

Answer:

C. Ss

Explanation:

One dominant allele (S) and one recessive allele (s) indicates a heterozygous trait.

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Answers

Answer:

B-Close the ring in the bearing or the ring in the bearing.

Explanation:

hope it's help

The correct answer would be (B) close the ring in the bearing or the ring in the bearing

Hope this helps! Merry Christmas to you all!!!

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

A biological factor that is correlated with borderline personality disorder is:
a)
a high level of testosterone.
b)
a low level of serotonin.
c)
a high level of serotonin.
d)
a low level of testosterone.

Answers

A low level of testosterone

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Answers

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Answer:

Both plant and animal cells have mitochondria because they both. need ATP for energy. ... Proteins are processed and modified in the interior of the.

Explanation:

Help help bell help help

Answers

6 units
because it is decreasing by three every time

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

why are the offspring of coral identical to the parent

they reproduce sexually so offspring have increased genetic variation

they reproduce asexually so offspring have increased genetic variation

they reproduce sexually so offspring have decreased genetic variation

they reproduce asexually so offspring have decreased genetic variation

Answers

Answer:

they reproduce asexually so offspring have decreased genetic variation

Explanation:

when an organism reproduces asexually, its offspring will look identical to the parent due to the offspring only receiving genes from one parent. I hope this helps!

What are examples of devices that use electromagnetic waves? Check all that apply.


-FM radios
-microwaves
=TV remote controls

Answers

Answer:

FM radios and TV remote controls.

Describe the structure and function of areolar connective tissue.

Answers

Answer:

Areolar Tissue is loose connective tissue that consists of a meshwork of collagen, elastic tissue, and reticular fibres - with many connective tissue cells in between the meshwork of fibres. The fibres that form the mesh structure of areolar tissue include: Collagen Fibres.

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

Answers

BB - brown nose, Bb - brown nose bB - brown nose and bb - blue nose.

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Answers

Answer:

Nervous system signal conduction in muscular movement

Explanation:

Hope i helped :)

14. The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answers

Question:-

The active site of an enzyme

a. Is where the semi-permeable membrane is located

b. Is a specific bulge of protuberance on an enzyme

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits

d. Rigidly resists any alteration of its shape

Answer:-

C. Is a groove or crevice in the structure of the enzyme into which the substrate fits.

Explanation:-

The active site is one such gap or pocket to which the substrate adapts and binds to the enzyme.

The active site is the region of the enzyme to which the substrate molecule binds and causes a chemical reaction. The active site is composed of amino acid residues that form a temporary bond with the substrate.

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Answers

Answer:

the first one

Explanation:

.

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

Answers

A pond organism that is unicellular, contains membrane-bound organelles and possesses a flagellum is a PROTISTA. It is a unicellular kingdom.

The Protista kingdom is composed of eukaryotic single-celled unicellular organisms.

Flagellated protists are microorganisms having a tail-like projection known as flagellum.

The flagellum is a structure used for motion, thereby, in general,  flagellated protists are found in moist environments (e.g., ponds, fresh-water, etc).

Learn more about the Protista kingdom here:

https://brainly.com/question/5186929

Identify the animal products and by-products you use throughout an entire day, and log them in a journal. Submit your journal and your reflection.

Answers

Answer: Products from animals include meat and meat products, poultry products (meat and eggs), fish, shellfish, dairy products (milk and cheese), and non-food products such as fiber (wool, mohair, cashmere, and leather).

Explanation:

Based on the numbers in the previous question, an 80–pound Earth girl would weigh about ___ pounds on the planet Namar.
A. 4
B. 320
C. 18
D. 40
please help

Answers

A :) lllllllu fluctuating

Scientists can determine the exact age of a fossil by how much carbon is left in the fossil. This is called

Question 9 options:

Both of these


None of these


Relative dating


Radiometric dating

Answers

Scientists can determine the exact age of a fossil by a technique called  Radiometric dating. Radiocarbon dating involves the determination of how much carbon is left in the fossil.

In radiocarbon dating, it is possible to determine how much carbon is left in the fossil, by looking at its half-life period.

Radiocarbon dating (also known as carbon dating) refers to the technique aimed at determining the age of a fossil by exploring the properties of a radioactive carbon isotope called radiocarbon.

Radiocarbon or carbon-14 (14C) is a radioactive carbon isotope of carbon that contains 6 protons and 8 neutrons, whose amount in a sample can de be used to determine the age of a given organic material.

Learn more about radiocarbon here:

https://brainly.com/question/12693872

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

Answers

Answer:

the phenotype of a mouse with genotype is g

Distinguish between dimorphic, polymorphic, and continuously variable traits.

Answers

Dimorphic, polymorphic, and continuously variable traits are distinguished as follows:

Dimorphism is the condition of those species of animals or plants that exhibit two anatomical aspects or two different forms.

When talking about polymorphisms in genetics, reference is made to the different variations that may exist on the DNA of the same gene.

Continuously variable traits are those that show a continuous distribution of phenotypes.

Therefore, we can conclude that dimorphism is a polymorphism with only two forms, the polymorphism is any stable change of the DNA fixed in the population and in continuously variable traits the phenotypes show a continuous series and cannot be easily grouped.

Learn more about polymorphic traits here: https://brainly.com/question/7882029

All of the following would result in a population increase except

- a high rate of immigration
- a higher death rate than birth rate
- a low rate of emigration
- a low birth rate

Answers

Answer: B

Explanation: because birth and immigration is making the group bigger zero deaths and animals leaving
Hope this helps.

The answer I would choose is a low birth rate.

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

pls help click the link answer​

Answers

Answer:

1. Transfer

2. Share

3. Subscript

4. Positive

Where does carbon dioxide come from during photosynthesis?

Answers

Answer:

Plants extract the carbon dioxide from the air and use it in photosynthesis process to feed themselves.

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

Which of the following correctly describes a graded potential?

Answers

Answer:

Graded potentials are changes in membrane potential that vary in size, as opposed to being all-or-none.

Explanation:

btw, where are the options?

The statement which correctly describes a graded potential is: amplitude of various sizes.

Graded potential refers to a temporary change in electric or membrane potential of a stimulus with respect to both its size and distance.

Amplitude can be defined as the maximum displacement of a wave when measured from its equilibrium position.

Thus, amplitude is measured vertically from an equilibrium position.

Generally, a graded potential is directly proportional in amplitude to the size of the stimulus that is send as an input due to the following:

DepolarizationHyperpolarization

In conclusion, the statement which correctly describes a graded potential is amplitude of various sizes.

Read more on graded potential here: https://brainly.com/question/25377211

Other Questions
Which statement accurately describes how the acceleration of an object in free fall changes?O A. It accelerates downward at a constant rate.OB. It accelerates downward at an increasing rate.C. It accelerates downward at an irregular rate.D. It accelerates downward at a decreasing rate. a convex lens has a focal length of 0.5 it is combined with a second lens so combination has power 2.5 diopter which of the following could be second lens A) concave lens focal length 2mB) convex lens focal length 0.5m C) concave lens 0.5mD) convex lens 2m Which political faction was most upset when the United States and Britain split territory in Oregon at the forty-ninth parallel Write the following equations. PLS HELP Jake has two dogs, Euclid and Pythagoras. Euclid is a smaller dog and Pythagoras is larger. Jake found that Pythagoras lost 13 pounds from January to June. If Pythagoras gains 1.2 times Euclids weight, Pythagorass weight would still be 1 4 pound less than he did in January. What is Euclids weight? (a) Write an equation that represents the scenario. Begin by defining your variable. (b) Solve the equation. Show your work. (c) What is Euclids weight? (d) Jake adopts a third dog, Riemann. Riemann weighs exactly twice what Euclid weighs. The combined weight of the three dogs is 1 60 2 pounds. What is Riemanns weight, and what is Pythagorass weight? Show your work. Blaine and her sister are identical twins riding roller coasters at Kinetic Kars. They each ride theroller coaster on their own once. Next time, they ride the roller coaster together. On which ridedo you think they have the most kinetic energy? Explain your answer using information from classactivities. A roller coasterproduces acceleration dueto changes in both speedand direction. ApplyingConcepts Describe theacceleration occuring at thisinstant on therollercoaster ride. The average laundry worker folds fivetowels in a minute, but Miss Parkerfolds eight! At the end of an hour,how many more towels has shefolded than the average worker? Why and how the Spanish were able to easily defeat the Aztecs? Distance between Bholu's and Golu's house is 9 km. Bholu has to attend Golu's birthday party at 7 O'clock. He started his journey from his home at 6 O'clock on his bicycle and covered a distance of 6 km in 40 min. At that point, he met Chintu and he spoke to him for 5 min and reached Golu's birthday party at 7 O'clock. With what speed, did he cover the second part of the journey? Calculate- his average speed for the entire journey. Help, please!fdlksjflksdjklfjalk how does cytokinesis happen in prokaryotes What is the maximum point OR minimun point of this equation? y = 1.8 ( x + 2.4 ) 2 + 2.4Thanks for ur help!!!!!!!! When citing a web page, what item is included that does NOT appear in a print source citation?links to additional informationthe date the material first appeared on the sitethe date you accessed the informationthe name of the page owner A linear function and an exponential function are shown below.Over which interval does the growth rate of the exponential function exceed the growth rate of the linear function? Judah worked at the bakery for 14 hours last week. He spent $12 of his earnings on a cake for his fathers birthday. If he was left with $86 after buying the cake, what is Judahs hourly wage?$6.14$7.00$8.00$9.63 The high school soccer booster club sells tickets to the varsity matches for $4 for students and $8for adults. The booster club hopes to earn $200 at each match. Let x be the number of studenttickets and y be the number of adult tickets.List some of the possible combinations of number of tickets they can sell to make $200. help me plsss! need help I need some help with this. solve for x. 2/x-3=x/12-4x