Answer:
The nervous system of a crab differs from that of vertebrates (mammals, birds, fish, etc.) in that it has a dorsal ganglion (brain) and a ventral ganglion. ... The ventral ganglion is located beneath the internal organs, between the legs.
Explanation:
Brainliest please?
a 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?
Answer:
a great week to week to week to week I was
Explanation:
yhbbljgh
In which structure would you expect to find a chloroplast?
A. Blood cell from a dog
B. Cell from sunflower leaf
C. Human skin cell
D. Liver cell from a penguin
Answer:
b.cell from a sunflower leaf
The structure that can have chloroplast is the cell from sunflower leaf. The correct option is B.
What is chloroplast?Chloroplasts are chlorophyll-containing organelles found in plant cells; they are necessary for Earth life because photosynthesis occurs in chloroplasts.
Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, as well as other plastids.
Chloroplasts are plant cell organelles that use photosynthetic energy to convert light energy into reasonably stable chemical energy.
They survive life on Earth by doing so. Chloroplasts also perform a variety of metabolic functions for plant cells, such as the generation of fatty acids and membrane lipids.
Chloroplasts are found in all green plants and algae. Chloroplasts can also be found in photosynthesis that don't appear green, such as giant kelp's brown blades or certain plants' red leaves.
Thus, the correct option is B.
For more details regarding chloroplast, visit:
https://brainly.com/question/11136550
#SPJ6
Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur
Explanation:
The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.
Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.
In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.
In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.
Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.
5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'
What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).
note: there are two answers for this question
Answer:
5'GATCGTAA3'
5'ATTCTAGA3'
Explanation:
As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.
Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.
DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.
What are the major causes for moving air masses in North America
Answer:
Air masses build when the air stagnates over a region for several days/weeks. To move these huge regions of air, the weather pattern needs to change to allow the air mass to move. One major influence of air mass movement is the upper level winds such as the upper level winds associated with the jet stream.
Explanation:
A major cause for moving air masses in North America is the upper-level winds.
An air mass refers to a large body of air that has identical conditions throughout. It should be noted that air masses take on the condition of the area where they're formed.
Air masses move due to winds and air currents. Moving air masses bring about changes in the weather. The air masses in North America include maritime polar, continental tropical, continental arctic, etc. A major cause for moving air masses in North America is the upper-level winds such as the one that's associated with the jet stream.
Read related link on:
https://brainly.com/question/19087228
The internal urethral sphincter is comprised of
Answer:
1) the internal urethral sphincter (IUS), which consists of smooth muscle and is continuous with the detrusor muscle and under involuntary control, and 2) the external urethral sphincter (EUS), which is made up of striated muscle and is under voluntary control.
Explanation:
Hope this helped!
Increased numbers of CAG repeats in the exon of a gene is associated with certain diseases. In a specific gene, the existing CAG codons are in the 'zero' reading frame, in- frame with the AUG initiation codon. The effect of increased numbers of CAG repeats on the encoded protein is:___________. a. to silence of the gene to generate a truncated protein b. to generate a protein with a run of consecutive glutamines c. to generate a frameshifted protein product d. none of the above
Answer:
The correct answer is - option b. to generate a protein with a run of consecutive glutamines.
Explanation:
The initiation code AUG is the code for methionine and as well as the initiation code for the particular protein or peptide chain. In this protein, there is a repeat of CAG is increased with the initiation code so, even though they are in zero reading frame they code for their amino acid which is glutamine.
So. an increased number of CAG repeats will result in a protein with the a run of consecutive glutamines.
Volcanic eruptions cause destruction, but they are also
Answer:
they also form rocks in earth surface
Answer:
Volcanic eruptions may cause destruction but they also create little islands like Hawaii.
The nutrient needed for growth and repair of body tissues is
carbohydrate
protein
mineral
Answer:
Protein is a nutrient used to make and repair our body cells (like blood and muscle cells). About 1/2 of your dry body weight is protein. If you do not eat enough carbohydrates, protein will be changed to carbohydrates so that you can get energy.
Answer:
protein
Explanation:
In gel electrophoresis, fragments are separated by size and electrical charge by applying __________ to them
Answer:
Gel matrix
Explanation:
Gel electrophoresis is a technique in molecular biology used to separate fragments of biomolecules such as DNA, RNA, protein by applying electric current through a GEL medium. The basis of separation of this fragments is their sizes and electrical charge.
In the gel electrophoresis procedure, a GEL medium made of Agarose is used. The DNA fragments, which are then negatively charged begins to move towards the positive end of the gel when electric current is supplied. The smaller fragments move/migrate faster than the larger ones towards the positive end. Therefore, In gel electrophoresis, fragments are separated by size and electrical charge by applying GEL to them.
What type of electricity ended up being the one we use in homes?
Question 5 options:
A)
DC
B)
AC
C)
Static
D)
Intra-atomic
Answer:
b
becaus3 tjfjrjfjr tjrjdjdne fjdjd
If you do a Gram-stained on a bacteria isolated from a healthy human intestine you will find mostly Gram positive spiral cells.
Select one
True
False
I can help you:)
Most bacteria can be stained with postitevly charged stains.So this is true .My friend had a test about this so he told me all about this topic and helped me learn about it and help you.
so there you go :)
Propane is burned to provide the heat in many cooking grills. The chemical
reaction for this process is shown in the equation below.
C3Hg +502 + 3 CO2 + 4H20 + energy
What are the products in this chemical reaction?
A. 3C02 + 4H20+ energy
B. C3H3 + 3C02 + energy
C. C3Hg + 502
O D. 4H20 + 502
Answer:
the products are shown in answer A
Explanation:
Most of the reactions of burning organic substances lead to the products CO2 and H2O and are exothermic.
Biodiversity is a measure of the:
Answer:
B.
Explanation:
Biodiversity is the diversity (variation) of biology (life). It measures the variation of life within an ecosystem. This directly correlates with B.
Explanation:
combines richness and evenness across species. it is often measured because high biodiversity is perceived a synonymous with ecosystem health
Imagine you were going to model the flow of energy in an ecosystem and the flow of elements in the ecosystem using a diagram
Compare and contrast your diagrams for these two systems.
Answer:
Only 10 percent of energy is transferred from one trophic to another while the elements transfer are proteins, carbohydrates and fats.
Explanation:
The flow of energy occurs in an ecosystem through a number of trophic. From the first trophic level to the second trophic level only 10 percent of energy is transferred while the rest of the energy is released in the form of heat energy. Flow of elements in the ecosystem refers to the elements that are essential for the survival of organism. These elements are present inside the foods which is eaten by these animals. Proteins, carbohydrates and fats are the elements transfer from one organism to another by eating the food.
15.Which of the following contain the genetic code? (Choose one: carbohydrates, nucleic acids, proteins).
16.Which of the following provide the most readily available energy? (Choose one: carbohydrates, lipids, nucleic acids, proteins).
Answer:
Protiens
Explanation:
because the DNA or RNA is translatted to sequence.
If we were to take a journey into ourselves, we would find 23 pairs of chromosomes, or ________ individual chromosomes, all packed in the nucleus of each cell.
Answer: It is 46
Explanation: 23 pairs =46
9. What type of bond is pictured in the image below?
a. covalent bond
b. ionic bond
c. metallic bond
d. electron bond
ONLY 9
Answer:
c. metallic bond
Explanation:
Metallic bonding, unlike other forms of atomic bonding, involves delocalized elections. The negatively charged electrons form a "sea" around metal cations. Electrons within the valence shells of metals are only held loosely within their molecular orbits- the metals are held together due to the strong attraction between these delocalized electrons and positive nuclei.
The electrons are typically described as mobile, free, and delocalized. These traits are responsible for several metallic properties such as:
electrical conductivityheat conductivityelectronegativitymalleabilityAnswer: Number 10 is also C
Explanation:
Which device was not invented in the early 1900s?
Question 7 options:
A)
Electric vacuum cleaner
B)
Electric refrigerator
C)
Electric toaster
D)
Electric car
Explanation:
Electric Vacuum cleaner- 1901
Electric Toaster- 1893
Electric refrigerator- 1913
Electric car - 1884
Answer: Electric Car
Can someone find an example of mutualism in this passage? Please help I wasted all my points :)
Answer:
the coral and the algae
Explanation:
they both get positive things out of this so this is mutualism
Glycolysis joins glucose to other molecules to make pyruvate. True or false
Answer:
false
Explanation:
The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.
Glycolysis is the first stage or process of cellular respiration in which -
one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysisC₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺ → 2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺
On the basis of the given explanation, it is evident that the given statement is a false statement.
Learn more about glycolysis:
https://brainly.com/question/10886602
Which of these is the representative organism for roundworms?
Snail
Spider
Leach
Sponge
Sea star
Coral
Roundworm
Fish
Some grass species use the C3 photosynthetic pathway and other grass species use the C4 photosynthetic pathway. As you move from North Dakota to Texas, explain why you think the percentage of grass species using the C4 photosynthetic pathway would increase, decrease, or stay the same.
Answer:
would increase
Explanation:
C3 plants are those where the first carbon compound produced during photosynthesis have three carbon atoms per molecule (instead of 4 in C4 plants). While higher is temperature and light, oxygen (O2) exhibits a higher affinity for Rubisco, a key enzyme in photosynthesis. In environmental conditions with high temperatures and light such as, for example, Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants (because these plants have different metabolic pathways). Thus, it is expected that the percentage of C4 plant species in the local grass flora increases as latitude decreases.
It should be noted that the percentage of grass species using the C4 photosynthetic pathway would increase.
It should be noted that C3 plants simply refer to those where the first carbon compound produced during photosynthesis has three carbon atoms per molecule rather than the four carbon atoms that are in C4 plants.
In environments with high temperatures and light such as Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants. Therefore, it is expected that the percentage of C4 plant species in the local grass flora will increase when there is a reduction in latitude.
Read related link on:
https://brainly.com/question/18766174
Recent research by Ravizza and colleagues suggests that students may spend as much as one-
typical class hour browsing the internet.
half
third
fifth
quarter
Need help on this question?
Answer:
one-half
Explanation:
According to that study done by Susan Ravizza and her colleagues students spent almost 40 minutes browsing the internet for nonacademic purposes. Since one class period is 100 minutes this would put it at almost one-half of the class period. They also found that the students used their phones for texting for around 27 minutes.
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of
1) Chlorophyll
(2) carbon dioxide gas
(3) nitrogen gas
(4) oxygen gas
Answer: oxygen
Explanation:
If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
What is chloroplast?Photosynthesis, the process by which light energy is transformed to chemical energy and results in the generation of oxygen and energy-rich organic compounds, takes place in the chloroplast, a structure found inside the cells of plants and green algae.
Close relatives of chloroplasts that are free-living are photosynthetic cyanobacteria; according to the endosymbiotic theory, these organisms are the ancestors of both chloroplasts and mitochondria, which are eukaryotic cells' energy-producing organelles.
Therefore, If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.
To learn more about chloroplast, refer to the link:
https://brainly.com/question/11136550
#SPJ2
PLEASE HELP ASAP IM ON A TIMER!!!
This image shows a volcanic eruption in Hawaii with lava flowing into the sea.
This image shows a volcanic eruption in Hawaii with lava flowing into the sea.
Which statement best describes this eruption?
1. Its magma is high in silica.
2. Its magma has low viscosity.
3. Its gases are released in rapid bursts.
4. Its lava came from an explosive eruption.
Answer:
4. its lava came from an explosive eruption
Answer:
4 its lava came from and explosive eruption
Explanation:
If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors
Modules Why are fossils an important piece of evidence for evolution? Collaborations?
Answer:
they are inportant because they show us how the animal evolved,why, and when. also they gie us clues about modern day animals
Explanation:
What is the estimated age of Earth?
A.4.6x10^6
B.4.6x10^7
C.4.6x10^8
D.4.6x10^9
Answer:
D: 4.6 x [tex]10^{9}[/tex]
Explanation:
4.6 x 10^{9} = 4,600,000,000
Earth is approximately, 4.6 billion = 4,600,000,000 = 4.6 x 10^{9}
The estimated age of Earth is 4.6x10⁹ years (D).
Scientists estimate the age of Earth through various methods, including radiometric dating of rocks and minerals. By analyzing the isotopes present in rocks and minerals, scientists can determine the decay rates of radioactive isotopes and calculate the time since the formation of those rocks.
Based on extensive studies and evidence, the current estimated age of Earth is approximately 4.6 billion years (4.6x10^9 years). This estimation is supported by multiple lines of evidence, including radiometric dating of rocks from different geological formations, lunar samples brought back from the Moon, and meteorites.
The age of 4.6 billion years is consistent with the age of the oldest rocks found on Earth's surface and the ages of the Moon and meteorites, which are believed to have formed around the same time as Earth. These dating methods provide a reliable framework for understanding Earth's geological history and the processes that have shaped our planet over billions of years.
It's important to note that scientific estimates and understanding of Earth's age continue to evolve as new evidence and research emerge. However, the current consensus among scientists is that the age of Earth is approximately 4.6 billion years, as indicated by extensive geological and radiometric dating studies.
To learn more about Earth, here
https://brainly.com/question/31064851
#SPJ2
How does a new cell become specialized into a heart cell?
A new cell become specialized into a heart cell when its structure can be changed into a heart cell.
When the cell become specialized into heart cell by changing its structure, it will be able to do the function properly. Cell differentiation is that process in which cells become specialized into different types of cells such as heart cell, liver cell etc. A stem cell is an unspecialized cell that change into specialized cells under specific conditions which force the unspecialized cell into specialized cell.
When the heart needs more cells then the stem cells start converting into heart cells by changing its form and structure. These specialized cells go to the place where they are needed the most and start their work so we can conclude that new cell become specialized into a heart cell by changing its structure.
Learn more: https://brainly.com/question/19209945