Duchenne Muscular Dystrophy (DMD) is an X-linked recessive trait that causes muscular weakness, deterioration of muscle tissue, and loss of coordination. The allele for DMD is represented by Xd and the normal allele is represented by XD . Neither parent has DMD, but both of their sons express the trait. What are the genotypes of the parents?

Answers

Answer 1

Answer:

The correct answer is - XDXd and XD Y

Explanation:

Sex-linked disorders are the disorders that are expressed only when there is two copy of the mutated allele or have not masked by the dominant allele of the gene. In DMD, the dominant allele is XD and the mutated allele is Xd. To express it there are the following genotype possible-

in women XdXd, and in men XdY, so these two genotypes are not possible for the parents in this case. If a mutated allele is present with the dominant allele it will be considered as carrier women but diseased will not be found in them.

So the correct genotype would be

mother: XDXd ( a carrier woman)

father : XDY (normal man)


Related Questions

Can someone find an example of mutualism in this passage? Please help I wasted all my points :)

Answers

Answer:

the coral and the algae

Explanation:

they both get positive things out of this so this is mutualism

Which device was not invented in the early 1900s?

Question 7 options:

A)

Electric vacuum cleaner


B)

Electric refrigerator


C)

Electric toaster


D)

Electric car

Answers

Explanation:

Electric Vacuum cleaner- 1901

Electric Toaster- 1893

Electric refrigerator- 1913

Electric car - 1884

Answer: Electric Car

can someone draw this for me and add the labels please thank you I suck at drawing ​

Answers

Answer:

Explanation:

sure, when is it due

What are the ways oxygen is transported in the blood, ranked according to the way that is responsible for the majority of transport of oxygen?

a. 1-dissolved in plasma, 2- Hb
b. 1-Hb, 2-HCO3, 3-dissolved in plasma
c. 1- dissolved in plasma, 2-Hb, 3-HCO3
d. 1-dissolved in plasma, 2-HCO3, 3-Hb
e. 1-HCO3, 2-Hb, 3-dissovled in plasma
f. 1- Hb, 2-dissolved in plasma

Answers

Answer:

f. 1- Hb; 2- dissolved in plasma

Explanation:

Transport of oxygen in the body occurs in two way; oxygen bound to hemoglobin and oxygen dissolved in plasma.

1. Bound to hemoglobin :

Hemoglobin, or Hb, is a protein molecule found in red blood cells and is responsible for the colour of red blood cells. It is composed of four subunits of two types of the protein globin: two alpha subunits and two beta subunits. Each subunit surrounds a central heme group (red in color) that can bind one oxygen molecule.Therefore, each hemoglobin molecule can bind and transport four oxygen molecules. About 98.5% of oxygen is transported in the body bound to hemoglobin.

2. Oxygen is only fairly soluble in blood plasma. As a result, only 1.5 percent of oxygen in the blood is dissolved and transported in blood plasma.

CLICK HERE PLEASE HELP

Answers

Answer:

step 3

Explanation:

answer:
c


explanation:

A smoke detector in a home uses what form of energy?
-solar
-chemical
-thermal

Answers

Answer:  smoke alarm is a smoke detector that can detect small particles of smoke common in home fires. This detector is activated by monitoring the electronic energy between two battery-powered metal  

Explanation: so chemical

what are the two classes of cells found in the human body
a) muscular and nervous
b) bone cells and endocrine cells
c) sex cells and somatic cells
d) permanent and temporary

Answers

Answer:  the answer is c

Explanation:

Different types of cells occurs in organisms. These cells differentiate right from the zygote stage to become more specialized as the individual grow.

The two classes of cells found in the human body include the sex cells and somatic cells (option C).

These two main classes encompasses all the various types of specialized cells. The somatic cells are also called the body cells. These cells are diploid in nature. While the sex cells are also known as the gametes. The sex cells include the sperm cell from the male and the egg cell from the female. In humans there are 22 pairs of body cells (autosomes) and a pair of sex chromosomes (XX for females and XY for males).

Learn more about the sex and body cells: https://brainly.com/question/927903

Modules Why are fossils an important piece of evidence for evolution? Collaborations?​

Answers

Answer:

they are inportant because they show us how the animal evolved,why, and when. also they gie us clues about modern day animals

Explanation:

Which process represents cellular division in body cells?

Answers

There are two types of cell division: mitosis and meiosis. Most of the time when people refer to “cell division,” they mean mitosis, the process of making new body cells. Meiosis is the type of cell division that creates egg and sperm cells. Mitosis is a fundamental process for life.

Explanation:

Cell division occurs during mitosis which means the chromosome pairs are split into two new cells.

The last two pictures show it in a visual way for you!

Hope this helps!!

Some grass species use the C3 photosynthetic pathway and other grass species use the C4 photosynthetic pathway. As you move from North Dakota to Texas, explain why you think the percentage of grass species using the C4 photosynthetic pathway would increase, decrease, or stay the same.

Answers

Answer:

would increase

Explanation:

C3 plants are those where the first carbon compound produced during photosynthesis have three carbon atoms per molecule (instead of 4 in C4 plants). While higher is temperature and light, oxygen (O2) exhibits a higher affinity for Rubisco, a key enzyme in photosynthesis. In environmental conditions with high temperatures and light such as, for example, Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants (because these plants have different metabolic pathways). Thus, it is expected that the percentage of C4 plant species in the local grass flora increases as latitude decreases.

It should be noted that the percentage of grass species using the C4 photosynthetic pathway would increase.

It should be noted that C3 plants simply refer to those where the first carbon compound produced during photosynthesis has three carbon atoms per molecule rather than the four carbon atoms that are in C4 plants.

In environments with high temperatures and light such as Texas when this state is compared to North Dakota, C4 plants tend to be more productive than C3 plants. Therefore, it is expected that the percentage of C4 plant species in the local grass flora will increase when there is a reduction in latitude.

Read related link on:

https://brainly.com/question/18766174


Imagine you were going to model the flow of energy in an ecosystem and the flow of elements in the ecosystem using a diagram
Compare and contrast your diagrams for these two systems.

Answers

Answer:

Only 10 percent of energy is transferred from one trophic to another while the elements transfer are proteins, carbohydrates and fats.

Explanation:

The flow of energy occurs in an ecosystem through a number of trophic. From the first trophic level to the second trophic level only 10 percent of energy is transferred while the rest of the energy is released in the form of heat energy. Flow of elements in the ecosystem refers to the elements that are essential for the survival of organism. These elements are present inside the foods which is eaten by these animals. Proteins, carbohydrates and fats are the elements transfer from one organism to another by eating the food.

Briefly explain how each layer interacts with electromagnetic radiation from the sun by describing the temperature changes that occur

Answers

Explanation:

The layers of atmosphere are differentiated on the basis of different temperature gradients.Thus,different layers within the atmosphere are created.

Toposphere is heated from the ground. Thus, with increase in altitude temperature decreases.

In the stratosphere, temperature increases with altitude. The direct heat source for the stratosphere is the Sun. Air in the stratosphere is stable because warmer, less dense air sits over cooler, denser air.

In Mesosphere temperature decreases with altitude. Few gas molecules present in mesosphere absorb sun's radiation.The heat source is the stratosphere below. The mesosphere is extremely cold, especially at its top, about -90°C.

Thermosphere which also contains ionosphere.The density of molecules is so low in here that one gas molecule could easily go upto 1 km before it collides with another molecule. It is so little energy is transferred, the air feels very cold

If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of

1) Chlorophyll
(2) carbon dioxide gas
(3) nitrogen gas
(4) oxygen gas​

Answers

Answer: oxygen

Explanation:

If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.

What is chloroplast?

Photosynthesis, the process by which light energy is transformed to chemical energy and results in the generation of oxygen and energy-rich organic compounds, takes place in the chloroplast, a structure found inside the cells of plants and green algae.

Close relatives of chloroplasts that are free-living are photosynthetic cyanobacteria; according to the endosymbiotic theory, these organisms are the ancestors of both chloroplasts and mitochondria, which are eukaryotic cells' energy-producing organelles.

Therefore, If the process illustrated in the diagram is interrupted by a chemical at point X, there would be an immediate effect on the release of oxygen gas.

To learn more about chloroplast, refer to the link:

https://brainly.com/question/11136550

#SPJ2

A student will measure and record the growth (in height) of two flowering plants every other day for 20 days. Each plant will receive 200mL of water each day, but only one plant will receive 10mL of fertilizer. whats the independent variable, dependant variable, and the standardized variable?

Answers

Answer:

The correct answer is -

the independent variable - if fertilizer added or not,

the dependant variable - the height of the plant and

the standardized variable - 200ml water

Explanation:

In this study, the student wanted to see the effect of the fertilizer on the growth of the plant so the independent variable is the treatment of the fertilizer as manipulated or the independent variable is the factor which is affected or changed purposely during an experiment while other variables remain constant.

The dependent variable is the factor that is based or depends on the independent variable and measured to see the effect which is the height of the plants in this case.

The standardized or the control variable is the variable that remains constant throughout the experiment, 200 ml water treatment is the control variable in this experiment.

Graphic organizer: Use the terms in the word bank to complete the graphic organizer below: Word Bank precipitate light substances chemical reactions properties color gas temperature ​

Answers

Hi, you've asked an incomplete question. Attached is the full image of the graphic organizer.

Answer:

chemical reactionssubstancespropertiesprecipitategascolortemperaturelight

Explanation:

After merging the missing words together, we can make this likely conclusion:

First, when chemical reactions (1) occur, they often indicate new substances (2), that is formed with new properties (3).

Next, we also note that some evidence of a chemical reaction occurring includes:

↓formation of:

a precipitate (4), or

gas (5)

↓change in:

color (6)

temperature (7).

↓production of:

light (8) A good example of this occurs when one burns wood by applying heat, there's usually a production of light.

production of oxygen during photosynthesis

Answers

Answer:

c

Explanation:

How does a new cell become specialized into a heart cell?

Answers

The new cell has to have the “code” as in the same DNA as the heart cell so it become a heart cell and if it don’t have the same “ code “ your body will reject the new cell

A new cell become specialized into a heart cell when its structure can be changed into a heart cell.

When the cell become specialized into heart cell by changing its structure, it will be able to do the function properly. Cell differentiation is that process in which cells become specialized into different types of cells such as heart cell, liver cell etc. A stem cell is an unspecialized cell that change into specialized cells under specific conditions which force the unspecialized cell into specialized cell.

When the heart needs more cells then the stem cells start converting into heart cells by changing its form and structure. These specialized cells go to the place where they are needed the most and start their work so we can conclude that new cell become specialized into a heart cell by changing its structure.

Learn more: https://brainly.com/question/19209945

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***.

5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'

What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).

note: there are two answers for this question

Answers

Answer:

5'GATCGTAA3'

5'ATTCTAGA3'

Explanation:

As requested in the question above, the primers were presented with 8 nucleotides, with the nitrogenous bases of the DNA, and in the 5'-3 'direction.

Primers are small fragments of DNA that are used by DNA polymerase to form new strands. The primes attach to pieces on the ribbon, through the complementarity of the nitrogenous bases, serving as a template for the DNA polymerase to create the new ribbon.

DNA polymerase uses primers at the origin of replication, and can follow the path from the right or from the left, depending on the primers used, for this reason, this question has two answers.

15.Which of the following contain the genetic code? (Choose one: carbohydrates, nucleic acids, proteins).
16.Which of the following provide the most readily available energy? (Choose one: carbohydrates, lipids, nucleic acids, proteins).

Answers

Answer:

Protiens

Explanation:

because the DNA or RNA is translatted to sequence.

If cells were a school building, the cell membrane would most likely be represented by which of the following?
А
intercom
B
lockers
С
teachers and students
D
walls and doors

Answers

d-walls and doors would represent the cell membrane

The internal urethral sphincter is comprised of

Answers

Answer:

1) the internal urethral sphincter (IUS), which consists of smooth muscle and is continuous with the detrusor muscle and under involuntary control, and 2) the external urethral sphincter (EUS), which is made up of striated muscle and is under voluntary control.

Explanation:

Hope this helped!

In which structure would you expect to find a chloroplast?
A. Blood cell from a dog
B. Cell from sunflower leaf
C. Human skin cell
D. Liver cell from a penguin

Answers

Answer:

b.cell from a sunflower leaf

The structure that can have chloroplast is the cell from sunflower leaf. The correct option is B.

What is chloroplast?

Chloroplasts are chlorophyll-containing organelles found in plant cells; they are necessary for Earth life because photosynthesis occurs in chloroplasts.

Proplastids give rise to chloroplasts, as do chromoplasts, leucoplasts, as well as other plastids.

Chloroplasts are plant cell organelles that use photosynthetic energy to convert light energy into reasonably stable chemical energy.

They survive life on Earth by doing so. Chloroplasts also perform a variety of metabolic functions for plant cells, such as the generation of fatty acids and membrane lipids.

Chloroplasts are found in all green plants and algae. Chloroplasts can also be found in photosynthesis that don't appear green, such as giant kelp's brown blades or certain plants' red leaves.

Thus, the correct option is B.

For more details regarding chloroplast, visit:

https://brainly.com/question/11136550

#SPJ6

Help please I am begging I am stupid :(

Answers

Answer:

Explanation:                                    b

Answer: if you need help get help

Explanation: help is like geting more egication and speed classes

have a nice rest of your day

are unsaturated fats less healthy than saturated fats

Answers

Unsaturated fats are healthier if eaten in healthy doses they lower LDL cholesterol levels and reduce risk of heart disease

The nutrient needed for growth and repair of body tissues is

carbohydrate
protein
mineral

Answers

Answer:

Protein is a nutrient used to make and repair our body cells (like blood and muscle cells). About 1/2 of your dry body weight is protein. If you do not eat enough carbohydrates, protein will be changed to carbohydrates so that you can get energy.

Answer:

protein

Explanation:

Suppose that the narrow‑sense heritability of ear length in Reno rabbits is 0.4. The phenotypic variance (VP) is 0.5, and the environmental variance (VE) is 0.1. Calculate the additive genetic variance (VA) for ear length in these rabbits.

Answers

Answer:

0.20

Explanation:

The narrow-sense heritability, denoted by h², refers to the ratio of additive genetic variance (Va) to the total phenotypic variance (Vp).

Mathematically, it can be written as:

h² = V(A)/V(P)

Where;

V(A) = additive genetic variance

V(P) = total phenotypic variance

V(A) = V(P) × h²

Based on the information provided in the question, V(P) = 0.5, h² = 0.4

V(A) = 0.5 × 0.4

V(A) = 0.20

The additive genetic variance (VA) for ear length in these rabbits is 0.2.

What are the major causes for moving air masses in North America

Answers

Answer:

Air masses build when the air stagnates over a region for several days/weeks. To move these huge regions of air, the weather pattern needs to change to allow the air mass to move. One major influence of air mass movement is the upper level winds such as the upper level winds associated with the jet stream.

Explanation:

A major cause for moving air masses in North America is the upper-level winds.

An air mass refers to a large body of air that has identical conditions throughout. It should be noted that air masses take on the condition of the area where they're formed.

Air masses move due to winds and air currents. Moving air masses bring about changes in the weather. The air masses in North America include maritime polar, continental tropical, continental arctic, etc. A major cause for moving air masses in North America is the upper-level winds such as the one that's associated with the jet stream.

Read related link on:

https://brainly.com/question/19087228

In gel electrophoresis, fragments are separated by size and electrical charge by applying __________ to them

Answers

Answer:

Gel matrix

Explanation:

Gel electrophoresis is a technique in molecular biology used to separate fragments of biomolecules such as DNA, RNA, protein by applying electric current through a GEL medium. The basis of separation of this fragments is their sizes and electrical charge.

In the gel electrophoresis procedure, a GEL medium made of Agarose is used. The DNA fragments, which are then negatively charged begins to move towards the positive end of the gel when electric current is supplied. The smaller fragments move/migrate faster than the larger ones towards the positive end. Therefore, In gel electrophoresis, fragments are separated by size and electrical charge by applying GEL to them.

Glycolysis joins glucose to other molecules to make pyruvate. True or false

Answers

Answer:

false

Explanation:

The given statement about glycolysis that it joins glucose to other molecules to make pyruvate is a false statement as glycolysis is a catabolic reaction for glucose molecules.

Glycolysis is the first stage or process of cellular respiration in which -

one glucose molecule is broken down and two molecules of pyruvate are generated.Four ATP molecules also generate, however, two ATP molecules are used, therefore, a net gain of two ATP molecules.It is the fundamental process that takes place in both aerobic and anaerobic (lactate formed instead of pyruvate) cellular respiration.summary of glycolysis

C₆[tex]H_{12}[/tex]O₆ + 2ADP + 2Pi + 2NAD⁺   →   2C₃H₄O₃ + 2H₂O + 2ATP + 2NADH + 2H⁺

On the basis of the given explanation, it is evident that the given statement is a false statement.

Learn more about glycolysis:

https://brainly.com/question/10886602

a 1000 kg car speeds up from rest to 25 m/s in 10 seconds.how much force acts on the car?​

Answers

Answer:

a great week to week to week to week I was

Explanation:

yhbbljgh

2500N
Use formula F=ma
* a= v/t
So F= m v/t
F=1000.25/10
F= 2500N
Other Questions
8. Which word is an antonym for outcome?A resultB. climaxC. originD. dnouement Une las frases en Ingls y espaol que describen el sistema educativo en Chile.1. Parvulariopreescolarocho aos2. Bsico3. Secundariotres a slete anoscuatro anos4. Superior cluster of air sacs in lungs are called ( )nucleusbronchibronchiolesAir spaces Ok Im gonna sound dumb for a sec but how did the Italian renaissance spread culture, Improve by accepting challenges, and conquer adversity? Which two sentences in these excerpts from Kate Chopins The Locket reflect the theme of holding on to love despite time and distance.The letter had made Edmond heart sick and home sick. He stretched himself on his back and looked straight up at the blinking stars. But he was not thinking of them nor of anything but a certain spring day when the bees were humming in the clematis; when a girl was saying goodbye to him. He could see her as she unclasped from her neck the locket which she fastened about his own. It was an old fashioned golden locket bearing miniatures of her father and mother with their names and the date of their marriage. It was her most precious earthly possession.Octavie wore a plain black dress, severe in its simplicity. A narrow belt held it at the waist and the sleeves were gathered into close fitting wristbands. She had discarded her hoopskirt and appeared not unlike a nun. Beneath the folds of her bodice nestled the old locket. She never displayed it now. It had returned to her sanctified in her eyes; made precious as material things sometimes are by being forever identified with a significant moment of one's existence.Octavie felt as if she had passed into a stage of existence which was like a dream, more poignant and real than life. There was the old gray house with its sloping eaves. Amid the blur of green, and dimly, she saw familiar faces and heard voices as if they came from far across the fields, and Edmond was holding her. It was as if the spirit of life and the awakening spring had given back the soul to her youth and bade her rejoice. Hurry!!! I need yall help;( In a brief paragraph, outline the ways in which OPEC is a trade barrier?PLEASE HELP THIS IS URGENT!!!! I need help finding the domain Which of the following best describes how Jonas feels about the Ceremony of Twelve?A. He is excited. His parents' words set his expectations highB. He is apprehensive. He doesn't know what he wants to be, only what he doesn't want to be.C. He is almost unaware of it. D. He is angry about it. He is frustrated that he won't see his friends as often. What is the solution to the equation 23(y6)=(y+2)+1?y=35y=15y=95y=275 To make Diane's special punch it take 4 cups of juice for every 7 cups of Lime soda. How much juice will be needed if we have 21 cups of soda? Using J for juice and S for soda, how will the equation look? write an essay about yourself based on the dimensions of ones personality Solve: -4(3-2x) = 6(3x + 3)Step by step ? This is pretty confusing please help!!!!! ___________ are reported in the business section of magazines or newspapers, as well as online. Please help me and if you are right and hurry I'll give you an extra 20 points!ActivityNow its your turn to write about an event or idea from two different perspectives. During the American Revolution, ideas were often written on posters. At the time of the Vietnam War, they were shared through radio and television. Today, people and groups post their thoughts on the Internet using social media sites or share them through text messages. Follow the directions below to write a conversation about a current event topic through text message, instant message, or status updates.1. Choose one of the following topics for your conversation:Soda tax Should people have to pay an extra tax on soda or junk food?2. Research your topic using the Internet or other reference material. You may want to start with local or national newspapers, television news sources, or online encyclopedias. Please contact your instructor if you are unable to find appropriate sources. You may also want to review this learning object for tips on finding and using information.3. Write a conversation between two people with different perspectives on your topic. Your conversation can be in the form of instant messages, text messages, or social media status updates. You may use this template to complete your assessment. Your conversation should include the following:A total of at least five entries for each side (10 entries totaltwo to three sentences each)Accurate facts used to support both perspectivesAt least two properly cited sources used for researchThank you so much if you actually help me I promise you that I will give you 20 extra points and brainliest! I promise! although I have ADHD T-T so you will have to remind me to give it to you because I will forget. There is gravitational force on the Earth from the Sun, and a gravitational force on the Sun from the Earth. Which pulls harder? (Ill give brainliest if u help!)Which equation has a value less than 54,811?A) 54,811 x 2 = ________B) 54,811 x one and two fourths = ________C) 54,811 x 1 = ________D) 54,811 x two fourths = ________ Language is symbolic. t or f 3 paragraphs of a made up favorite holiday doesnt matter what holiday