English adjectives also go AFTER the noun that they describe
True
O
False

Answers

Answer 1
The statement is true

Related Questions

Quieres saber qué hacían ayer por la tarde las personas indicadas. Haz preguntas, usando la forma apropiada del imperfecto de los siguientes verbos. Usa las pistas que se dan.


MODELO: montar la rueda de Chicago (él)

¿Montaba él en la rueda de Chicago?

1. viajar a San Salvador (ella)


2. trabajar en el parque de atracciones (Uds.)


3. gritar en la montaña rusa (él)


4. hablar con un amigo mexicano (tú)


5. aprender español (nosotros)


6. jugar con los globos (tú)


7. correr (ellos)


8. dormir en su cuarto (él)


9. leer (yo)


10. escribir e-mails (nosotros)


11. acostarse (Ud.)


12. divertirse en el carrusel (Uds.)

Answers

¿Viajaba ella a San Salvador?
¿Trabajábais ustedes en el parque de atracciones?
¿Gritaba él en la montaña rusa?
¿Hablabas tú con un amigo mexicano?
¿Aprendíamos nosotros español?
¿Jugabas tú con los globos?
¿Corrían ellos?
¿Dormía él en su cuarto?
¿Leía yo?
¿Escribíamos e-mails nosotros?
¿Os acostásteis ustedes?
¿Os divertíais en el carrusel ustedes?
Be careful: I have answered in Spanish from Spain, in America you could answer in another way.
The most correct thing is that the subject is omitted.

Conjuga los siguientes verbos en la forma correcta del pretérito y traduce el verbo a inglés.

Answers

1. Almorzaremos
2. Pagará. My uncle will pay for my plain ticket.
3. Explicaré. I will explain my plans for the trip.
4. Sacaste. You get books out from the library.
5. Juega. My cousin plays basketball.
6. Practicó. I practice sports.
7. Comienzan. My grandparents started to do exercise.
8. Llegaré. I will be late for the theater.
9. Tocamos. Maria and you play the piano.
10. Empezará. It will start to rain at 7.

Use the future tense to describe what you think your soulmate (alma gemela) will be like. This person could be your romantic soulmate or a lifelong best friend. What physical and personality characteristics will they have? Where do you think you’ll meet them? What interests will you share?

Your response must contain 5 complete and detailed sentences in Spanish. Use 5 different verbs in your response.
Your response needs to be at least 30 seconds in length.

Answers

Answer:

Explanation:

Mi alma gemela, es decir, mi verdadero amor, deberá ser mi "príncipe azul" el cual siempre me halagará con los detalles que a mi me gustan.

Mi alma gemela será una persona simpática, con un gran sentido del humor.

Estoy segura que pronto encontraré a esta persona ideal, me imagino que se presentará conmigo vistiendo elegantemente y brindándome muchas atenciones y yo me dejaré llevar por sus encantos y su gran forma física.

Digo que pronto lo encontraré porque la próxima semana iré de vacaciones a Cancún y ahí, en la playa lo encontraré brillando, resplandeciente, casi como un ángel.

Los temas de interés que tendremos en común no serán, inicialmente, muy importantes, ya iremos tratándonos y sabré como tenerlo a mi lado, le hablaré de lo tanto que él significa para mí.

Escoge la mejor respuesta de acuerdo al contexto dado. Una persona que sufre un ataque de otra es la ___, Victima enganar detective problema

Answers

Víctima is the right answer.

Una persona que sufre un ataque de otra es la víctima.

this is a word search
8th grade, pls show the editing

Answers

Here it is !! Hope I’m on time sorry if I’m not

Read and choose the option with the best explanation of why it is important to learn Spanish as a reporter.
To broadcast accurate news from foreign countries
To book vacation packages and cruises in other nations
To sell food and souvenirs in international fairs
To teach language and culture to immigrant populations

Answers

im not sure but i think it’s “To broadcast accurate news from foreign countries”

I need help with my math cut my b no one answered this one and I put the wrong subject

Answers

Answer:

what?

Explanation:

Answer:

Explanation:

what is the question?

Rubén, no quiero que tengas un mal día, pero es necesario que te (1)
(decir) algo importante sobre tu audición en el teatro.

Answers

Rubén, no quiero que tengas un mal día, pero es necesario que te algo importante sobre tu audición en el teatro. Sorry if I’m late

5. ¿Cuál es la palabra clave para recordar las reglas de acentuación?
a) SEGA
b) AGES
c) ALEG
d) GESA

Answers

I think it would be the B) AGES

Answer:

¿Cuál es la palabra clave para recordar las reglas de acentuación?

a) SEGA

5. Which of these would you not see in Copán? (
Ochariot
Oball field
Opyramid
O staircase

Answers

i’m pretty sure it’s chariot

1 + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 = max you answer

Answers

Answer:

45

Explanation:

45

have a great day mates ✌✨

Fill in the blank

Yo no ______ en el auto.

A. Cabo
B. Quepo

Answers

Answer:

a?

Explanation:

Answer:

cabo is the correct answer

hope it is helpful to you

Fill in the blank

_____ la una de la tarde.

A. Son
B. Es

Answers

La respuesta es “B”

Answer:

Ambos significan lo mismo

They both mean the same

De los cuentos que leì, mencionó el que más me gustó y digo por qué
cuento: Cabeza de gallo
ayuda plis solo es para mañana ​

Answers

En este ejercicio, tienes que mencionar un cuento y explicar por qué te gustó. En este caso, el cuento dado es Cabeza de gallo.

El cuento es sobre un chico que debe realizar un sacrificio en una fiesta religiosa, con los ojos vendados debe pegar a un gallo. En un momento del cuento, una iglesia se incendia y todas las personas que estaban alrededor de él y el gallo corren hacia la iglesia. Cuando el chico llega a la iglesia, encuentran a quien ha realizado el sacrificio y él recuerda otra mirada en la de este hombre (la del gallo).

Entonces, debes explicar por qué te gustó el cuento que elegiste. Esto es personal, ya que para cada persona puede ser diferente pero estos son algunos ejemplos:

El cuento trata sobre una temática original.El mensaje del sacrificio del gallo y el sacrificio en la iglesia.Es corto, fácil de entender e interesante.

Puedes chequear más información en el siguiente link https://brainly.com/question/21532140?referrer=searchResults  

Read and choose the correct option to complete the sentence.
La casa de sus padres está en el bosque, en
limpio, tranquilo y verde.
O un ambiente
O un terremoto
O un humo
un desastre

Answers

it’s the first one. en un ambiente limpio,tranquilo y verde. your welcome

Answer:

sería la primera un ambiente

What does the underlined word mean in the following sentence?
No quiero *dormir*.

O to eat
O to sleep
O to get used to
O to give

Answers

Answer:

to sleep

Explanation:

Dormir means to sleep and the full sentence is "I don't want to sleep"

Answer:

to sleep

Explanation:

dormir means to sleep

just doo part b pleaseeeeeee

Answers

Answer:

yo disfruto jugar futbol americano y a mi hermana maria le gusta jugar a las raquetas, me senti un poco mal porque juan jugaba solo asi que juan y yo nos pusimos a jugar juntos y mis otros hermanos dijieron que porque haciamos eso, que mejor nos fueramos con ells a nadar y yo respondi que no, les dije, a ustedes les gusta nadar pero a mi no, y dijo mi prima sonia que fuera co ella pero respondi lo mismo, le dije, tu juegas soccer porque te gusta pero a mi ese es un deporte que no me gusta, todos en esta casa somos diferentes, y respetamos nuestros gustos

Explanation:

solve number 6. please dont guess​

Answers

Answer:

Lupe y Anita son organizadas y extrovertidas

Explanation:

son in English means are or they are ...in Spanish you use this word when referring to multiple people

Answer:

Lupe y Anita son organizadas y extrovertidas.

Explanation:

this is the correct answer as it's plural and it's in female terms (a) not male terms (o)

I speak Spanish regularly. When you are only doing females you use (a) when you are either only doing males or doing both males and females you use (o). Lupe and Anita are both females therefore using (o) is very improper. I don't want you to fail due to a simple mistake.

¿Dónde se celebra el Cinco de Mayo más?



España
los Estados Unidos
México
Australia


THE ANSWER IS B
i just got 100%

Answers

Answer: I

Explanation:

Answer: B

Explanation: took the quiz on edg got this one right!

ompleta la siguiente conversación con las palabras de la lista.

boca / cita / cabeza / descansar / duele / gripe / lengua / enfermera / medicina / oídos / sientes
DR. BURGOS: Hola, Sonia. ¿Cómo te (1) ?
SONIA: Me (2) mucho la (3) .
DR. BURGOS: Abre la (4) , saca la (5) y di aaa.
SONIA: Aaa.
DR. BURGOS: Ahora voy a ver tus (6) .
SONIA: ¿Qué tengo, doctor?
DR. BURGOS: Creo que tienes la (7) . Espera aquí. La (8) te va a dar una (9) . Debes tomarla cada seis horas. También necesitas (10) en cama.
SONIA: ¿Hago una (11) ?
DR. BURGOS: Sí. Regresa la próxima semana.

Answers

Answer:

la mujer

Explanation:

that means the woman

1- sientes 2- duele 3- cabeza 4- boca 5- lengua 6-oídos 7-gripe 8- enfermera 9- medicina 10- descansar 11- cita

Completa el siguiente párrafo con las formas apropiadas del imperfecto.
Mis padres me (1. llevar) al parque de atracciones los fines de semana cuando yo (2. tener) ocho años. Nosotros siempre (3. hacer) lo mismo: primero (4. montar) en la montaña rusa y (5. gritar) mucho. No me (6. gustar) montar en globo. ¡Qué miedo! Luego nosotros (7. caminar) por el parquet y (8. parar) muchas veces para comer algo y para tomar unos refrescos. Yo siempre (9. comer) en menos de cinco minutos, pero mis padres (10. tardar) más tiempo. Cuando nosotros (11. terminar) de comer, yo (12. montar) en el carrusel varias veces y luego, (13. pedir) un globo para llevar a casa. Yo siempre (14. querer) un globo rojo y mis padres siempre me (15. comprar) uno. Nunca me (16. dar) un oso de peluche porque ¡ya (17. tener) muchos!

Answers

1) llevan

2) tengo

3) hacemos

4) montó

5) gritó

6) gusta

7) caminamos

8) paramos

9) como

10) tardan

11) terminamos

12) montó

13) pido

14) quiero

15) compran

16)dan

17) tengo

Hoy tengo un día muy pesado. Ya salgo (1) 1 of 8 la tienda Super llantas a comprar una llanta (2) 2 of 8 el carro, luego voy (3) 3 of 8 el taller a llevarla, después voy a ir a comprar el regalo (4) 4 of 8 Juan José, hoy es su cumpleaños. (5) 5 of 8 la tarde debo ir con Camila (6) 6 of 8 su vestido de fiesta porque (7) 7 of 8 la noche vamos todos a celebrar el cumpleaños en el restaurante Las Tapas del Sur. (8) 8 of 8 eso te estoy llamando a esta hora. Hablamos mañana, chau.
¡Qué día! Fill in the blanks Activity
Instructions
Completa el párrafo con por o para.

Answers

Hoy tengo un día muy pesado, Ya salgo para la tienda Super llantas a comprar una llanta PARA el carro y luego voy PARA el taller a llevarla después voy a ir comprar el regalo PARA Juan José hoy es su cumpleaños POR la tarde debo ir con Camila POR su vestido de la fiesta porque POR la noche vamos todos a celebrar el cumpleaños en el restaurante las tapas del Sur POR/PARA (por or para are correct) eso te estoy llamando a esta hora hablamos mañana chao

Please help need done soon

Answers

Try looking up Primer Paso and the title of the work sheet book. That’s how I normally find the answers to those :)

Dé las palabras definidas. ¡OJO! Incluya el artículo definido (el, la, los, las) en las respuestas.

Answers

Las noticias
El asesinato
El periódico
El periodista
El maltratador/el abusador
La huelga
El testigo

Answer:

Explanation:

El noticiario.El atentado, El asesinato.El periódico.El reportero.El terrorista.La huelgaEl testigo.

Para describir un posible viaje a España, complete las siguientes oraciones con la forma apropiada del condicional y
la información indicada.
Please be correct

Answers

We can fill in the blanks in Spanish using the given information and the verbs in the conditional by writing what we would do if we were to travel to Spain.

Iría a España con mi familia.Viajaría en verano porque me encanta el clima cálido y disfrutar de las playas.Hablaría español todo el tiempo para practicar y mejorar mis habilidades en el idioma.Comería platos típicos como paella, tapas y churros.Vería un espectáculo de flamenco.Querría explorar lugares históricos durante el viaje.Me gustaría conocer a gente local durante mi visita.No podría volver a casa sin probar la famosa paella.

The conditional in Spanish

Conditional sentences in Spanish, also known as "oraciones condicionales," express hypothetical or speculative situations and their potential outcomes. They consist of two parts: the "si" clause (if clause), which presents the condition, and the main clause, which expresses the result or consequence.

There are three main types:

Type 1 (present-future): If the condition is fulfilled in the present, the result will happen in the future.Type 2 (imperfect-subjunctive): If the condition were fulfilled in the present, the result would happen in the present or future.Type 3 (pluperfect-subjunctive): If the condition had been fulfilled in the past, the result would have happened in the past.

With that in mind, we can conclude we have appropriately answered this question.

Learn more about Spanish here:

https://brainly.com/question/18552923

#SPJ1

PLZ HELP
we knew it in spanish

Answers

Answer:

nosotros sabíamos

Explanation:

Nosotros lo sabíamos

dramática / extranjera/ hizo / obra maestra /
personaje / tocó / tragedia
.0
1. Anoche vi Volver, una película
sea internacional, del director español Pedro
Almodóvar.
2. Penélope Cruz
el papel del
principal, Raimunda.
3. En la película, el público puede
una representación auténtica de cómo son los
españoles de los pueblos pequeños.
4. Como toda buena película
hay
momentos de
-quién no se rie
con el "fantasma de la madre de Raimunda- y
elementos de
que son muy
tristes.
5. No sé si Volver sea la
de
Almodóvar, pero a mi me fascino.

Answers

Answer:

extranjerahizopersonificardramatismoobra maestra

Explanation:

The complete sentences in Spanish with appropriate words are presented below:

Anoche vi Volver, una película extranjera, o sea, internacional, del director español Pedro Almodóvar.Penélope Cruz hizo el papel del protagonista principal, Raimunda.En la película, el público puede tener una representación auténtica de cómo son los españoles de los pueblos pequeños.Como toda buena película hay momentos de comedia, ¿quién no se ríe con el "fantasma de la madre de Raimunda" y elementos de tragedia que son muy tristes.No sé si Volver sea la obra maestra de Almodóvar, pero a mí me fascinó.

How to complete sentences in Spanish

In this question we have five sentences and seven choices, both in Spanish, and we must fill the blanks of the former with the words from the latter. The correctness of the chosen words depends on the context behind each sentence.

Lastly, we finally present the complete sentences in Spanish with appropriate words:

Anoche vi Volver, una película extranjera, o sea, internacional, del director español Pedro Almodóvar.Penélope Cruz hizo el papel del protagonista principal, Raimunda.En la película, el público puede tener una representación auténtica de cómo son los españoles de los pueblos pequeños.Como toda buena película hay momentos de comedia, ¿quién no se ríe con el "fantasma de la madre de Raimunda" y elementos de tragedia que son muy tristes.No sé si Volver sea la obra maestra de Almodóvar, pero a mí me fascinó.

To learn more on sentences in Spanish, we kindly invite to check this verified question: https://brainly.com/question/3936334


Choose the option that best translates the following sentence:
24.I refused to write that letter.
Traté de escribir esa carta.
O No quise escribir esa carta
O Me negué a escribir esa carta.

Answers

Me negué a escribir esa carta

Which of the following Mexican generals was ready for the attack by Napoleon?
A. Ignacio Allende
B. Ignacio Zaragoza
C. Lucio Blanco
D. Manuel Doblado​

Answers

Answer:

The answer for this is B about 5,000 Mexicans fortified the town.

El mesero _____ neustra order.

a.) escribes
b.) escribo
c.) escribe
d.) escriben​

Answers

Answer:

escribe is the answer

Explanation:

El mesero escribe nuestra orden
C
Other Questions
The decay of radioactive elements occurs at a fixed rate. The half-life of a radioisotope is the time required for one half of the amount of unstable material to degrade into a more stable material. The half-life of Carbon-14 is 5,730 years. Choose ALL the true statements regarding the Carbon-14 isotope.A) 100 grams of C-14 decays to 25 grams in 11,460 years. B) The C-14 isotope is only useful for dating fossils up to about 50,000 years old. C) A sample contained 3,360 atoms of C-14. 8 half-lives passed and 210 C-14 atoms remained. D) If an ancient bone contains 6.25% of its original carbon, then the bone must be 22,920 years old. E) A sample of 4,000 radioactive C-14 atoms undergoes decay. After 5 half-lives there are 800 radioactive atoms remaining. The Finishing Department had 6,800 incomplete units in its beginning Work-in-Process Inventory which were 100% complete as to materials and 40% complete as to conversion costs. 18,600 units were received from the previous department. The ending Work-in-Process Inventory consisted of 3,800 units which were 50% complete as to materials and 40% complete as to conversion costs. The Finishing Department uses first-in, first-out (FIFO) process costing. How many units were started and completed during the period What is a theme of "in Just-"? Children should not trust strangers. O Children cannot relate to adult problems. Spring is a joyful time Outdoor play is more fun than indoor play. Plz answer quickly will you brainlist why did weimar Republic collapse Find the value of x. 2 3 6 Match the value chain activity in the left column with the scenario in the right column.Value Chain ActivityScenario1.Service activities2.Inbound logistics3.Marketing and sales activities4.Firm Infrastructure5.Human resource management6.Technology7.Procurement8.Outbound logistics9.OperationsChoose from:Assembly line, Buying (sourcing) raw materials, CEO and CFO, Delivery to the firm's customer, New-product development, Receiving dock and raw materials, Surveys for prospect customers, Warranty work, Worker recruitment Describe how the Spanish-American War was started? In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed