Explain an example of a Progressive reform at either the local, state, or national level in each of the following areas:

Political
Social
Economic
How did the Progressive movement affect the election of 1912

Answers

Answer 1

Answer:

An example of a Progressive reform at either the local, state, or national level is described below in details.

Explanation:

The principal purposes of the Progressive movement were discussing difficulties generated by urbanization, industrialization, political corruption, and immigration. The movement essentially targeted political organizations and their administrators. Reformers desired legislation to defend workers and poor people, to reform administration, and to regulate business.

Answer 2

Answer:

Answer Below

Explanation:

The principal purposes of the Progressive movement were discussing difficulties generated by urbanization, industrialization, and political corruption. The movement essentially targeted political organizations and their administrators. Reformers desired legislation to defend workers and poor people, to reform administration, protect natural resources, and regulate business. They reformed businesses to give more economic opportunities to all, all people should have the same level of advantages. They provided union rights for workers, such as the right to get paid when injured. They broke up monopolies, reduced tariffs so that there could be a decrease in costs for consumers. They protected and conserved natural resources, and reformed the government. 


Related Questions

Which of the following statements best explains how some neurons in the primary auditory cortex help people recognize and distinguish between the sounds they hear?
A.) Some neurons prefer a certain frequency, such as high sounds.
B.) Some neurons combine information from the specialist cells.
C.) Some neurons categorize sounds into their specific frequency.
D.) Some neurons process specific types of sounds, such as voices.

Answers

Answer:

Option-C

Explanation:

The primary auditory cortex is a collection of neuron present in the superior temporal gyrus of the temporal lobe.

The neurons which are the fundamental unit of a nervous system in the primary cortex of the brain are specialized to interpret and discriminate the components or elements of sounds.  

The neurons can categorize the elements of the sound into their specific frequency i.e they can categorize the elements like pitch and loudness of sound which have different frequencies.

Thus, Option-C is the correct answer.

Answer:

C

Explanation:

Edge

What research methods do psychologists use, and for what purposes?

Answers

Answer:

Case studies, surveys, naturalistic observation, and laboratory observation are examples of descriptive or correlational research methods. Using these methods, researchers can describe different events, experiences, or behaviors and look for links between them.

What are the categories that forest ecologists use to group trees?A)dominant, codominant, tridominant, and quaddominantB)high, intermediate, low, groundC)dominant, codominant, intermediate, suppressedD)high, low, ground, and sublevel 

Answers

Answer:

C

Explanation:

:)

Answer:

C.) dominant, codominant, intermediate, suppressed

Explanation:

got it right on edge 2021

Which of the following best describes the effects of the trade routes on the societies of West Africa?

They increased the average person’s standard of living, leading to increased freedom and greater gender equality.
They led to larger urban cores that used professional armies to increase their territory and enslave people.
They disrupted major empires, paving the way for an increase in religious diversity.
They led to deindustrialization as imported goods destroyed local crafts, creating economies based on raw resource extraction.

Answers

Answer: They led to larger urban cores that used professional armies to increase their territory and enslave people.

Explanation:

Trade routes to West Africa before European colonization was led by Muslim traders who came and converted people to Islam whilst trading.

This trade created large urban areas that grew so rich from trade that they were able to command and maintain larger armies which they used to increase their territories and conquer neighbouring lands and enslave their people. This was how the Songhai and Mali empires became so powerful.

Which part of a computer is the primary data processing component

Answers

The CPU or the Central Processing Unit

How would you be able to determine whether your position on the Earth has moved?

Answers

Explanation

Look up at the sky and you can see the constellations, moon and sun are in a different position to where you were previously. Then you know you have changed position on the earth.

Look up at the sky and you can see the constellations,moon and sun are in a different position to where you were previously. Then you know you have changed position on the earth.

How do our interactions with others help in discovering who we are?

Answers

We are who other people say we are. Our selves are constantly being formed by our most important others. Self-esteem comes from relationships and not from the self. Just as we never learn how to love ourselves without loving another first. They work in tandem but if you really want to learn to love yourself, love another well. If you want to know yourself, know another person well.

Help please and thank you

Answers

Answer:

The answer is either A, B, C, D, or E.

Explanation:

Julio sells computers at an electronics store. Let the random variable C represent the number of computers that Julio sells in one week. The following table shows the probability distribution of C.

Answers

Answer:

the expected value of Julio earning for one week is $1,462

Explanation:

The expected value of Julio earning for one week is shown below:

But before that

First determine E(c)

= 1 × 0.08 + 2 × 0.16 + 3 × 0.21 + 4 × 0.3 + 5 × 0.18 + 6 × 0.03

= 3.31

The earning is

= $800 + $200 C

= $800 + $200 × 3.31

= $800 + $662

= $1,462

Hence, the expected value of Julio earning for one week is $1,462

Other Questions
A basketball player made 44 out of 100 attempted free throws. What percent of free throws was made? An article tells the life story of an inventor. It begins with his birth then discusses his years at school. After exploring his great inventions, the article ends with his death.Which choice best describes how the author organized information? Cause and effect Chronological order Fact by fact Problem-solution can someone give me an example of transformation of electrical to mechanical energy ill mark u as brain list HELP PLZ What connections can we make between finding the slope of a line connecting two points and the distance between those same two points? 1. 42+14x2. 3(2x + 9) what is the value of y in the solution to the system of equations 5x-y=25 and x+4y=-10 Any body got common lit answers 3 Drag the tiles to the boxes to form correct pairs. Match the expressions with the property used to generate 5y + 2y+ 6+2. Distributive Property 6y - y + 2y + 10 - 4 + 2 5y + 2(y + 3) + 2 combining like terms 5y + 2 + 6 + 2y Commutative Property cared How can I solve .6 x .5 Which is a like radical to 3 sqrt 54 and 3 sqrt 128 when the expression are simplified? Which rule applies to the translation of the RED trapezoid to the BLUE trapezoid?)(c.y) - (x* 2, y- 3)B)(x. y) - (x+ 4, y- 5)(x, y) - (x + 2, y - 5)D)(.Y) - (x- 2, y - 5) what color is the darkest.A. RedB. BlueC. purpleD. Black Read this excerpt from from Robinson Crusoe:Then I took my turn, and embraced him as my deliverer,and we rejoiced together. I told him I looked upon him as aman sent from Heaven to deliver me, and that the wholetransaction seemed to be a chain of wonders (243).Based on the wording in this excerpt, which of the following is Crusoe mostlikely describing?O A. A mutineerOB. A cannibalOC. The captainOD. Friday the measure of G is 82. What is the measure of its compliment? facts on wourld war 2 TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA HELP! SSUUUUUUUUPER EASY! REEEEEEEEEEEALLY QUICK! I'm just du. mb Below is an equilateral triangle. Find the value of x, then find the value of a side length. How do we use positive and negative signs to communicate the direction of a vector Fill in the question mark area of the dimensional analysis set up with the correct conversion 3.25 x 10-3 molecules H2O x 1 mole moles PLEASSSS HELPPPP