explain the characteristics of living things

Answers

Answer 1

Living things have a number of characteristics that set them apart from nonliving things. These characteristics include Organization, Metabolism, Growth and development, Response to stimuli, Reproduction, Homeostasis, Adaptation.

Organization:

Living things are highly organized, with a clear hierarchy of structures from the smallest (such as cells) to the largest (such as entire organisms).

Metabolism:

Living things are able to convert energy from their environment into forms that they can use to sustain themselves. This process is known as metabolism.

Growth and development:

Living things grow and change over time. This can involve physical changes, such as getting taller or developing new body structures, or it can involve changes in behavior or function.

Response to stimuli:

Living things are able to sense and respond to stimuli in their environment. This can involve physical responses, such as moving toward or away from a stimulus, or it can involve changes in behavior or function.

Reproduction:

Living things are able to reproduce, either sexually or asexually, in order to create new individuals of their own kind.

Homeostasis:

Living things are able to maintain a stable internal environment, even when the external environment is changing. This process is known as homeostasis.

Adaptation:

Living things are able to adapt to their environment in order to survive and thrive. This can involve physical adaptations, such as developing new body structures or behaviors, or it can involve genetic adaptations, such as the evolution of new traits.

Learn more about living things:

https://brainly.com/question/28532386

Answer 2

Living things have the following characteristics: growth, movements, respiration, excretion, nutrition, and reproduction.

GROWTH: All living things grow in some way or another. Be it an increase in the number of cells due to cell division, or the proper organization of the cell, all living things show some sort of growth.

MOVEMENT: Living things are mobile in nature. They show some sort of movement in their lifetime.

RESPIRATION: Living things respire. it is a chemical reaction that causes energy to be released from the food that they intake.

EXCRETION: It is the process of excreting or removing the products that are formed during the breakdown of food that the being does not require.

NUTRITION: It is the process in which the living thing intakes nutrition. It can happen in different ways in different beings.

REPRODUCTION: It is the process in which the organism creates its progeny and passes on genetic information to it. It has various levels of complexity depending on the organism.


Related Questions

EMOTIONAL COORDINATION IS. *

1 point

THE ABILITY TO USE PERSONAL ENTHUSIASM TO IMPROVE THE EMOTIONAL STATE

OF OTHERS

THE ABILITY TO QUICKLY REGULATE AN EMOTIONAL RESPONSE WHEN FACED WITH

A VARIETY OF IMMEDIATE SOCIAL AND EMOTIONAL CHALLENGES

THE ABILITY TO APPLY THE ENERGY CREATED FROM AN EMOTIONAL RESPONSE (IE:

ANGER, SADNESS, FRUSTRATION, ETC. ) IN A POSITIVE AND CONSTRUCTIVE WAY

THE ABILITY TO RESPOND POSITIVELY AND OPTIMISTICALLY IN A VARIETY OF

SOCIAL AND EMOTIONAL SITUATIONS, AND TO REGAIN OPTIMISM WHEN NEGATIVE

EVENTS OCCUR

THE ABILITY TO EMPATHIZE WITH OTHERS AND RESPOND APPROPRIATELY AND

PRODUCTIVELY TO PROVIDE SOCIAL AND EMOTIONAL SUPPORT

THE ABILITY TO STABILIZE THE EMOTIONAL RESPONSE TO A POTENTIALLY

UNSTABLE SOCIAL AND EMOTIONAL SITUATION

Answers

The ability to use personal enthusiasm to improve the emotional state of others is called empathy.

The term "empathy" refers to a wide concept that describes one's cognitive and emotional responses to another person's perceived experiences. The possibility of assisting others and displaying compassion rises when one has empathy. Therefore, empathy is the capacity to use one's own excitement to enhance the emotional well-being of others.

It is not required to have the same experiences or situations as others in order to feel and show empathy. Instead, empathy is an effort to comprehend the other person more fully by learning about their point of view. Emotional intelligence is the ability to understand, manage, and control your own emotions in order to reduce stress, communicate properly, empathize with others, conquer challenges, and resolve conflict (EQ).

To know more about emotional intelligence, refer to the following link:

https://brainly.com/question/7905042

#SPJ4

How do you rule a X-linked recessive pedigree?

Answers

Ruling a X-linked recessive pedigree involves analyzing the family history and pattern of inheritance of a trait or disorder to determine if it is likely to be inherited in an X-linked recessive pattern.

The disorder can be identified by:

Construct a pedigree by gathering information about the family history of the trait or disorder. Identify the pattern of inheritance by analyzing the transmission of the trait or disorder within the family. X-linked recessive disorders typically show a pattern of transmission in which affected males are only found in the direct line of descent from a female carrier. If the disorder is only found in males and not females, or if it is found mostly in males, it could be X-linked recessive.Exclude other possible modes of inheritance. Confirm the mode of inheritance by performing genetic testing. Genetic tests such as DNA sequencing or linkage analysis can be used to identify the specific genetic mutation causing the disorder in affected family members. Identify the specific gene mutation. With the help of genetic testing and linkage mapping it's possible to identify the specific gene and the mutation that causes the disorder.

To know more about Pedigree analysis, click here,

brainly.com/question/14525981

#SPJ4

How will the positive and negative transcription factor help maintain the homeostasis of the body system. Explain with an example

Answers

The positive transcription factor will help in maintaining the stimulus for homeostasis or even accelerate it. Whereas the negative transcription factor will oppose the effect of the stimulus, it can either increase it or decrease it.

Homeostasis is the maintenance of a steady and equilibrated physical, chemical and internal state of the body. The example of positive transcription factor is: activation of one clotting factor in the body initiates a cascade for the activation of all the other clotting factors.

Negative transcription factor has the example of blood glucose levels of the body. If the level increase transcription factors cause the release of insulin from the pancreatic cells to maintain the homeostasis.

To know more about homeostasis, here

brainly.com/question/3888340

#SPJ4

This is English can I still get help!

Answers

Answer: I believe the order of answers should be 2, 3, 4.

Explanation:

Part A seems like it is describing a strange character. Part B is appearing to depict a mysterious event. Part C describes a positive interaction.

(If this is wrong, I am terribly sorry, but I do hope this helps!)

The correct аspect of аn Аmericаn myth:

1. Rip now felt а vаgue аpprehension steаling over him; he looked аnxiously in the sаme direction, аnd perceived а strаnge figure slowly toiling up the rocks, аnd bending under the weight of something he cаrried on his bаck. ⇒ Remarkable, strange, or exaggerated characters (2) and positive message about a nation and its people (4)

2. Her deck once red with heroes’ blood. Where knelt the vаnquished foe. When winds were hurrying o’er the flood. Аnd wаves were white below. ⇒ Set in the past, often remote areas and exiting times (1)

3. Thanks, thаnks to thee, my worthy friend, for the lesson thou hаst tаught! Thus аt the flаming forge of life, our fortunes must be wrought: thus on its sounding ⇒ Incredible, heroic, impressive, magical or mysterious events (3)

The story "Rip Vаn Winkle" is а greаt exаmple of Аmericаn Mythology becаuse of the remаrkаble chаrаcters, the incredible аnd unbelievаble events thаt occur, аnd the fаct thаt it gives hope аnd presents positive messаges аbout Аmericа through the long journey Rip tаkes in the story.

The poem titled 'Old Ironsides' penned by Oliver Wendell Holmes explores the theme of 'pride in bаttle аnd deаth.' The speаker feels proud of receiving аn honorаble deаth. The poem is centered аround а ship thаt served in numerous bаttles but still doomed to be discаrded.

The quote from "Longfellow’s Blacksmith" tells about the Blаcksmith understаnds thаt he cаn forge his own future, by аny method he deems fit. А life worth living will require thousаnds of hаmmer swings, but he is in full control of how thаt hаmmer is swung.

For more information about American myth refers to the link:

https://brainly.com/question/17267555

#SPJ1

How do we know whether or not a heteromorphic chromosome such as the Y chromosome plays a crucial role in the determination of sex

Answers

The Y chromosome contains the "male determining gene," the SRY gene. This gene causes testicles to form in the embryo and results in the development of male genitalia. The SRY gene is important in sex determination in mammals and some insects.

Chromosomes are part of the structure of the human body, which consists of DNA and other molecules, and is the place where genetic material is stored.

To determine sex, the so-called X and Y chromosomes. If the embryo's chromosomes are XX, then it is female. Conversely, if the XY chromosome then the fetus will be born as a boy

Sex chromosomes are usually heteromorphic, that is, they show differences (size, shape, or reaction to staining) between their homologous chromosomes. Individuals having heteromorphic sex chromosomes can produce two types of gametes. For example, human males can produce gametes that have 22+X or 22+Y chromosomes.

Learn more about the Y chromosome at https://brainly.com/question/21057614

#SPJ4

How is it possible to take a cell with 46 chromosomes and create 4 cells with 23 chromosomes each?

Answers

You must divide them Deadd h

Which of the following organelles are involved in the general category of organelle heredity?
A) mitochondria and chloroplasts
B) R factors
C) Lysosomes and peroxisomes
D) Factors and episomes
E) Golgi and rough endoplasmic reticulum

Answers

The organelle in charge of transmitting hereditary features is the nucleus. The nucleus, represented by the letter Q, is where DNA is located. Choice B seems to be the appropriate answer as a result.

What characteristic of the cell determines heredity?

We now know that the genetic material of the cell is stored in the DNA. Diagram 4-2. On the other hand, the main function of cellular proteins found in chromosomes is to control and bundle extremely long DNA molecules into manageable bundles that can fit into mitochondria and just be easily accessible by them.

What organelle contains the basic components of life's genetic code?

Nucleus. The DNA deoxyribonucleic protein is housed in the nucleus, which is also known as the "command center" of the cell. Every single of the cell's processes, including.

To know more about DNA visit :

brainly.com/question/264225

#SPJ4

What is an irony definition?

Answers

Definition of irony as a narrative character is a scenario in which there is a contradiction between expectations and reality.

A scenario in which there is a contradiction between expectation and realities is what literary irony is defined as. For instance, the contradiction between what something seems to signify and what it actually means. Tragic and comic events are both connected to irony.

The word "irony," which first appeared in the English language in the sixteenth century, is derived from the Latin word "ironia" and the French word "ironie." All of these expressions have their roots in Eiron, a stereotypical figure from ancient Greece. An Eiron figure defeats his adversary by exaggerating his weaknesses, partaking in a form of irony by expressing less than what he really means.

You can also learn about irony from the following question:

https://brainly.com/question/1695719

#SPJ4

in what tissues, cells and organ does ependymoma first start

Answers

It begins in the spinal cord or brain

Which of the following expalins why folate is critical to the health of a newly conceived embryo?
A. Folate is essential for heart function
B. Folate is essential for maintaining prioper fluid balance
C. Folate is needed for spinal cord formation
D. Folate regulates bone formation

Answers

Answer:

I believe the answer is D. Folate regulates bone formation.

Explanation:

Hope it helps:)

State one way the two molecules could differ that would explain the difference in their ability to pass through the artificial plant cell membrane.

Answers

The two molecules could differ which would explain the difference in their ability to pass through the artificial plant cell membrane because molecule A is smaller than molecule B.

There аre multiple fаcts thаt cаn justify thаt two molecules show the difference in their аbility to pаss through а membrаne:

Size аnd moleculаr weight Receptors on the membrаne аnd the moleculesStructure of the membrаneMembrаne аffinity

Different molecules hаve different solubility depending upon the type of molecule аnd membrаne. So, the two molecules could differ which would explain the difference in their ability to pass through the artificial plant cell membrane because of the size of the molecules.

For more information about the size of molecules refers to the link:  https://brainly.com/question/20556821

#SPJ4

Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. Co A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate. Moving to another question will save this response

Answers

Correct statement which best descibes the addition of nucleotide is a) a nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.So,correct option is a.

A nucleoside triphosphate is a nucleotide containing a nitrogenous base bound to a 5-carbon sugar (either ribose or deoxyribose), with three phosphate bunches bound to the sugar. They are the sub-atomic antecedents of both DNA and RNA, which are chains of nucleotides made through the cycles of DNA replication and transcription. Nucleoside triphosphates likewise act as a wellspring of energy for cell reactions and are associated with flagging pathways.

Nucleoside triphosphates can't be consumed well, so they are regularly orchestrated inside the cell. Blend pathways contrast contingent upon the particular nucleotide triphosphate being made, yet given the numerous significant jobs of nucleoside triphosphates, union is firmly directed in all cases. Nucleoside analogs may likewise be utilized to treat viral infections. For instance, azidothymidine (AZT) is a nucleoside simple used to forestall and treat HIV/Helps.

Hence,correct statement is given in option a.

To know more about Nucleoside triphosphates, visit here:

https://brainly.com/question/14077575

#SPJ4

(Complete question) is:

Which of the following best describes the addition of nucleosides to a growing DNA chain?

a)A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.

b)A nucleoside diphosphate is added to the 3' end of the DNA, releasing a molecule of phosphate.

c)A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

d)A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of phosphate. Moving to another question will save this response

how can the silent march best be described the silent protest

Answers

Answer:

There is no singing or chanting, just the muffled thump of drums.

Explanation:

what is the similar between an estuary zone and intertidal zone

Answers

An estuary zone and an intertidal zone are both areas along the coast where freshwater and seawater mix. Both are affected by the tidal movements of the ocean and support a wide variety of plants and animals adapted to living in these environments. Both estuaries and intertidal zones are important ecosystems that provide habitat for many species and support economic activities such as fishing and tourism. They are also vulnerable to pollution and other human impacts and are often protected and preserved

In a transformation experiment, a sample of E. coli bacteria was mixed with a plasmid containing the gene for resistance to the antibiotic ampicillin (ampr). Plasmid was not added to the second sample. Samples were plated on nutrient agar plates, some of which were supplemented with the antibiotic ampicillin. The results of E. coli growth are summarized below. The shaded area represents extensive growth of bacteria; dots represent individual colonies of bacteria. Plates that have only ampicillin resistant bacteria include which of the following?
a. I only
b. III only
c. IV only
d. I and II

Answers

Option A, The plasmid containing the amp gene was added to the first sample of E. coli, but not to the second sample. Therefore, only the first sample should contain bacteria that are resistant to ampicillin.

This is represented by the shaded area on the plate I, which indicates extensive growth of bacteria. Plates II, III, and IV do not have any shaded area, meaning that there is no extensive growth, and only dots representing individual colonies of bacteria.

Since the plasmid was not added to the second sample it does not have resistance to the antibiotic. This means that plates III and IV, which contain the antibiotic, will not have any ampicillin-resistant bacteria and thus the answer is a. I only.

To learn more about E. coli bacteria at

https://brainly.com/question/18722309?referrer=searchResults

#SPJ4

What is the danger of engaging in unprotected pre marital sex?

Answers

Engaging in unprotected premarital sex can be dangerous as it increases the risk of sexually transmitted infections (STIs) and unintended pregnancies, and can also have emotional and mental impacts.

Engaging in unprotected premarital sex can be dangerous because it increases the risk of sexually transmitted infections (STIs) and unintended pregnancies.

STIs, such as HIV, chlamydia, and syphilis, can be transmitted through unprotected sexual contact. Some STIs can cause serious health problems and even death if left untreated. Some STIs, like HPV or herpes, may not show any symptoms, but can still cause long-term health issues.Unintended pregnancies can also occur as a result of unprotected premarital sex. This can lead to a variety of personal, social, and economic challenges, including emotional and financial burdens, interruptions to education or career plans, and the need for parenting or adoption arrangements.Additionally, unprotected premarital sex can also have emotional and mental impacts, such as guilt, regret, or emotional distress.It's worth noting that practicing safe sex, including the use of condoms and other forms of contraception, can greatly reduce the risk of STIs and unintended pregnancies, as well as emotional and mental distress.

To learn more about unprotected pre-marital sex at

https://brainly.com/question/29795968?referrer=searchResults

#SPJ4

compare the air pollution of Uttar Pardesh, Arunachal Pradesh, and Meghalaya

Answers

Answer :uttar Pradesh is more polluted than any of these.

Explanation:

Ligaments ere very strong but resistant to stretch Which protein fiber probably predominates?
a. Collagen b. Elastic c. Reticular d. Adipose

Answers

Ligaments are extremely strong but not stretchable. Most likely, collagen protein fiber is predominant.

Which of the aforementioned structures resists stretching?

The primary structural element of connective tissue, collagens withstand tensile or stretching stresses. There are about 40 different forms of collagens, but four of them are the most prevalent.

What distinguishes the holocrine gland from the merocrine and apocrine secretions?

Products are produced and then secreted by merocrine glands. Apocrine gland cells store its fluids until they rupture and discharge their contents, whereas apocrine gland cells release secretions by clamping off the apex region of the cell. In this instance, the cell joins the secretion.

To know more about Collagen visit :

https://brainly.com/question/28320324

#SPJ4

Why do whales need oxygen?

Answers

Whales need oxygen for respiration processes because they do not have gills, and whales are unable to breathe oxygen that is dissolved in water.

The lack of gills, which prevent whales from breathing oxygen dissolved in water, is the most obvious distinction between whales and other fish. Instead, they have lungs, which means that whenever they want to breathe air, they have to come to the surface.

They can stay underwater for hours at a time because they have a very efficient respiratory system that allows their lungs to get the most out of each breath. To put things in perspective, when we are at rest, humans breathe about 12 to 20 times per minute, but they only take in 5% of the oxygen in a single breath. This is in contrast to a whale, which can absorb up to 90% of the oxygen it breathes. This indicates that a whale takes in significantly more oxygen in a single breath than a human does.

Know more about Respiration here: https://brainly.com/question/12605249

#SPJ4

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Answers

ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.

What is DNA?

Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.

The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.

Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.

Learn more about DNA, here:

https://brainly.com/question/21992450

#SPJ1

PLSSS HELP IF YOU TURLY KNOW THISS

Answers

Answer:

It's A.

Explanation:

Because owls and hawks have different Pray to catch and different species

The answer here is a idcverf errrffr we

Buffalo grass is a species of plant found on the grazing prairie of Wyoming. It is a tough grass that has silicates (compounds containing oxygen and silicon) that reinforce its leaves. This variation has allowed this type of grass to survive for many years in an adverse environment. This is an example of which mechanism of evolution? O Mutation O Natural Selection O Gene Flow Genetic Drift​

Answers

As the variation of tough grass that has silicates (compounds containing oxygen and silicon) that reinforce its leaves has allowed this type of grass to survive for many years in an adverse environment, this is an example of b. natural selection.

This particular type of grass has adapted over time to survive in an adverse environment, due to its silicates (compounds containing oxygen and silicon) reinforcing its leaves. This is an example of natural selection, showing how the grass has been able to survive for many years despite the difficult conditions.

The variety of grass characterized by silicates (oxygen and silicon compounds) in its leaves has enabled it to survive in difficult environments over the years. This is a prime example of natural selection at work.

To learn more about natural selection, click here:

https://brainly.com/question/23929271

#SPJ4

Please helppp me its due tomorrow’s ‼️‼️ ☹️☹️

I only need help with g. It’s the last one

Thank youuu sooo muchhh

Answers

the answer to your question is yes

A parent cell has 28 chromosomes and completes meiosis. How many chromosomes result in each cell produced

Answers

If a parent cell has 28 chromosomes then the number of chromosomes in the daughter cell produced after the cell undergoes meiosis is 14 chromosomes.

Meiosis is a cell division process for gamete production. It helps in the sexual reproduction of eukaryotes. Gametes produced from two parents will unite to form the zygote, which thus contains a combination of unique sets of chromosomes inherited from two parents.

Hence each daughter cell will have half the no of chromosomes as that of their parents. So the number of chromosomes in each of  the daughter cells is 28/2 = 14 chromosomes. In meiosis 1 the number of chromosomes becomes half while in meiosis 2 , it is similar to mitosis, so the number of chromosomes remains the same.

For further learning about meiosis, follow the link:

https://brainly.com/question/30080589

#SPJ4

What is the best evidence we have for evolution ?

Answers

The continuity of the fossil record from ancient to contemporary times may be the strongest fossil evidence supporting evolution.

We don't find things like mammals in strata from the Devonian, the age of fishes, or human fossils alongside dinosaur remains anywhere on Earth. Evolution that is, common descent, gradualism, species diversification, and natural selection are the five hypotheses that Darwin united. A theory is an explanation for how a natural phenomenon functions that has undergone extensive testing through observations and experiments intended to establish the validity of the explanation. In this context, evolution might be considered both reality and a theory. The fact that creatures have altered or evolved over the course of Earth's history is undeniable.

Learn more about Evolution here:

https://brainly.com/question/6111443

#SPJ4

2. Experiment: Click Play and hunt peppered moths on dark tree trunks for five years. In each

year, try to capture as many moths as you can.

When you are done, select the TABLE tab and record the percentages of each moth type.

Year

Dark moths

Light moths

o

1

2

3

4

5

Answers

The total number of moths captured yearly is five. Inwhichoneis light moths and the other three are dark moths.

Moths come in a wide range of sizes, with wingspans that range from roughly 4 mm (0.16 inch) to nearly 30 cm (about 1 foot). They are highly adaptive and can survive anywhere but in arctic regions. Moths have scale-like coverings on their wings, body, and legs that fall off when the insect is handled. Moths have sturdier bodies and duller coloring than butterflies. Moths also have recognizable thick or feathered antennae. Moths retain their wings stretched at their sides or folded tent-like over their bodies when at rest, whereas butterflies hold their wings upright.

Learn more about moths here:-

https://brainly.com/question/15101218

#SPJ4

For every described currently living species of organism, there are about ________
fossil species.
O 2
O 1/6
O 100
O 6
O 1/100

Answers

For every described currently living species of organism, there are about 1/6 fossil species.

What is fossil species?

Fossil species are species that have been preserved in the fossil record. Fossil species are usually the remains of ancient organisms that lived millions of years ago, and are found in sedimentary rocks. They provide a window into the evolutionary history of the Earth, and are important for understanding the relationships between extinct and living species. Fossil species are also used to reconstruct ancient environments and ecosystems. Fossil species can be identified by their morphology, or physical characteristics such as size and shape.

To learn more about fossil species
https://brainly.com/question/11829803
#SPJ1

What are the 3 main species that make up the mollusk group?

Answers

The three main groups of mollusks are bivalves, gastropods, and cephalopods. Out of which Gastropod is the largest class.

In general, gastropods include snails and slugs. Bivalves are having hin.ged shells also called val.ves examples include clams, mussels, and oysters. Cephalopods include the octopus and squid.

The phylum Mollusca has many distinctive features and  special characteristics, which include a mantle cavity, visceral mass, foot, and radula. Gastropods have a special characteristics that includes spirally-coiled external shell while others mollusks usually have a flattened shell, and many of them doesn't  possess any shell as outer structure.

To learn more about Mollusks , here

brainly.com/question/28737614

#SPJ4

What was the most significant conclusion that Mendel?

Answers

The most significant conclusion that Mendel drew from his experiments is that 'Traits are inherited in discrete units one from each parent'.

The main conclusion that Mendel drew from his experiments is that traits are inherited from each parent in his individual units and are not the result of interbreeding. He called these separate substantive factors pairs.

Mendel's main conclusion, drawn from his experiments with peas, is that factors are inherited as discrete units and do not exhibit mixing.

The peas he used in his experiments were a good choice because of their distinct contrasting traits, hermaphrodite flowers, short lifespan, and less variation in results with crosses.All monohybrid and dihybrid crosses he considered phenotypic and genotypic ratios were identical.

Genes are now discovered to be pieces of DNA that reside on chromosomes, but Mendel did not know which genes (Mendelian factors) consisted. A study of chromosome behavior was carried out by Sutton and Boveri with the aid of a microscope. They later compared it to the behavior of factors and genes.

For more information on Mendel's experiment , visit :

https://brainly.com/question/30097040

#SPJ4

Complete question :

What was the most significant conclusion that Mendel drew from his experiments?

A There is considerable genetic variation in garden pea

B Traits are inherited in discrete units one from each parent

C Genes are composed of DNA

D Recessive genes occur as frequently as dominant ones.

Researchers put mice who had been eating either a Low Carb or a Control diet onto treadmills at different speeds and measured heart rate. Their data are below. The R2 values for each line represent • Control O Low carb diet - Control -----Low carb
(Pict. Diagram)
o the significance of the linear fit o whether or not the slopes are significantly different from zero o the amount of variation explained by the regression line o standard deviation of the slope

Answers

Based on the research given, the answer would be C. the amount of variation explained by the regression line

This statistic displays the percentage of the variance in the dependent variable that the independent factors collectively explain. The R-squared statistic offers a simple 0–100% scale to express the degree of the relationship between your model and the dependent variable.

Variation refers to any distinction between individuals within a species or between populations of animals from different species. Genetic diversity is primarily brought about by mutation, but it is also influenced by other biological processes as sexual reproduction and gene flow. Linear regression is a linear strategy for modelling the connection between a scalar answer and one or more explanatory factors. When there is only one explanatory variable, simple linear regression is employed; when there are many explanatory factors, multiple linear regression is utilised.

To learn more about regression line: https://brainly.com/question/17004137

#SPJ4

Other Questions
Which of the following are the factors of the equation x 2 3x 4 0? a car travels at a constant speed.what does the gradient of a distance-time graph of the car's journey represent?distance the car travelled, the area under the graph,the speed of the car, the acceleration of the car Which of the following is true?O Two objects with the same speed always have the same velocity.O The velocity of an object can change even if the speed of the object remains constant.O Velocity describes how fast an object is changing speed.O Velocity is independent of direction. which country did the united states embargo, or stop trading with, prior to joining the war? The average age of Elliot, Miya and Cara is 4 years more than the averageage of Elliot and Miya.Cara is 9 years older than Elliot.Four years ago, Elliot was double the age of Miya.Work out the ages of Elliot, Miya and Cara. Can someone help with these 2 questions please :) or 1 whichever one u know1. Overall, how successful were resistors to Spanish colonial rule? What factors prevented them from being more successful?2. What lasting impacts do you think Spanish colonial rule will have on Native American cultures and civilizations? Explain. What are the 4 tools of totalitarianism? In a certain year, 31% of adults in a certain country viewed college education as essential for success. For the following ten-year period, this percentage increased by approximately 2. 6 each year. The percentage of adults from this country who viewed a college education as essential for success x years after the first year can be represented by __ ________ was the forerunner of the English Reformation, who objected to the pope's interference in English politics. A school administrator wants to know what proportion of teachers in their state have a Master's degree. The administrator takes an SRS of 100100100 teachers from a statewide database containing every teacher, and they find 555555 teachers in the sample have a Master's degree. The administrator wants to use this data to construct a one-sample zzz interval for a proportion.Which conditions for constructing this confidence interval did their sample meet How is the logarithmic function y log x defined? A team of scientists claim that they have discovered a new experimentalmethod for determining atomic mass. Which of the following is necessary forthe claim to be considered valid?A. The atomic mass of an element according to the new methodmust be greater than its previous measurement.B. The method must work for all isotopes.C. The atomic mass of an element according to the new methodmust be less than its previous measurement.OD. Another team of scientists must be able to replicate the results ofthe experiment.SUBMIT Ellie brought 2 packs of hot dogs , 3 lbs of hamburger, and 2 lbs. of potato salad. How much did she spend? Understanding and relating to the needs of others is called Multiple choice question. benevolence. empathy. ennui. introspection. Carolina is mowing lawns for a summer job.for every mowing job,she charges an initial fee plus $6 for each hour of work.her total fee for a 4-hour job,for instance is $32 What is equivalent to 4 6? If the person up for re-election does something their constituents dislike, what would most likely happen? How much are people in the House of Representatives susceptible (vulnerable) to their constituents' feelings? How can I raise my credit score 20 points fast? A cubical box has each edge 10 cm and another cuboidal box is 12.5 cm long, 10 cm wide and 8 cm high. Which box has the greater lateral surface area and by how much What are the benefits of recreational activities that affect ourselves physically mentally and spiritually?