Factor this problem. Give me a good answer.(no spam, bots, etc.)

Will give brainlyist<sorry if it isn't spelled right>to the correct answer

!!!DUE TODAY!!!​

Factor This Problem. Give Me A Good Answer.(no Spam, Bots, Etc.)Will Give Brainlyist&lt;sorry If It Isn't

Answers

Answer 1

Answer:

4m(-2m+2m-1)

Step-by-step explanation:

nothing to explain because i am bad at maths.


Related Questions

The dimensions of a rectangular prism are 5 cm, 5 cm, and 2 cm.
Determine the surface area.
OA.
A. 50 cm
B. 25 cm
OC. 60 cm
D. 120 cm
O E. 90 cm

Answers

Answer:

E

Step-by-step explanation:

Givens

L = 5 cm

W = 5 cm

H = 2 cm

Formula

SA = 2L*W + 2L*H + 2*W*H

Solution

SA = 2*5*5 + 2*5*2 + 2*5*2

SA = 50 + 20 + 20

SA = 90 cm^3

2) Find AC
C
12° 15°
70
B
А

Answers

The answer is = 12 15

solve for bc !.??.?.?.?.

Answers

Answer:

A) 12

Step-by-step explanation:

all triangle CBF is similar to triangle GEF by aa similarity.

EF/BF = EG/BC

6/18 = 4/BC

therefore BC must be 12.

Find the area (in square inches) of an equiangular triangle with a radius of length 6 in.

Answers

The area of equiangular triangle with radius 6 inches is 27√3 square inches.

What is equiangular triangle?

A triangle with three equal interior angles is called equiangular triangle.

In an equiangular triangle, the measure of each of its interior angle is 60 degrees. Since, all the angles are equal therefore all the side will also be equal.

What is the formula for finding the area of equiangular triangle?

The formula for finding the area of equiangular triangle is

[tex]Area = \frac{\sqrt{3} }{4} a^{2}[/tex]

Where,

a is the side length of the triangle.

Let the side length of the equiangular triangle be a.

According to the given question.

We have a equiangular triangle with a radius 6.

Since, the radius of the equilateral triangle or equiangular triangle is given by

Radius = [tex]\frac{a}{\sqrt{3} }[/tex]

⇒ a = 6√3 inches.

Therefore, the area of equiangualr triangle is given by

[tex]Area = \frac{\sqrt{3} }{4} (6\sqrt{3} )^{2}[/tex]

⇒ [tex]Area = \frac{\sqrt{3} }{4} \times 36 \times 3[/tex]

[tex]\implies Area = 27\sqrt{3}[/tex]  square inches

Hence, the area of equiangular triangle with radius 6 inches is 27√3 square inches.

Find out more information about area of equaingular triangle here:

https://brainly.com/question/2272529

#SPJ2

Please help. This makes 0 sence also fast because this is a big test I need to pass don’t just guess please?!

Answers

It's B : 5/9 = 0.555… .

To see why, let x = 0.555… . Then 10x = 5.555…, and

10x - x = 5.555… - 0.555…

9x = 5

x = 5/9

Why the other answers are wrong:

• It's not A because 3/10 = 0.3, while 1/3 = 0.333…

• It's not C because 9/100 = 0.09, while 1/11 = 0.090909… :

x = 0.090909…

100x = 9.090909…

100x - x = 9.090909… - 0.090909…

99x = 9

x = 9/99 = 1/11

• It's not D because 47/99 ≠ 0.475475475… :

x = 0.475475475…

1000x = 475.475475475…

1000x - x = 475.475475475… - 0.475475475…

999x = 475

x = 475/999 ≠ 47/99

rewrite the function by completing the square. f(x)=x^2-9x+14​

Answers

Answer:

f(x)=(x-9/2)²-25/4

Step-by-step explanation:

f(x)=x²-9x+14

f(x)=x²-9x+(-9/2)²-(-9/2)²+14

f(x)=(x-9/2)²-81/4+14

f(x)=(x-9/2)²+(-81+56)/4

f(x)=(x-9/2)²-25/4

Answer:

Step-by-step explanation:

A rocking horse has a weight limit of 60 pounds. What weight is 95% of the limit? *​

Answers

Answer:

57

Step-by-step explanation:

60*0.95 = 57

Answer:

57 pounds is 95 percent of the limit.

Step-by-step explanation:


Please help meeeeeeeeeeeeeeeee

Answers

Answer:

Step-by-step explanation:

h = 4.2 in

Volume = 3.6  cubic inches

[tex]\frac{1}{3}\pi r^{2}h = 3.6\\\\\frac{1}{3}*3.14*r^{2}*4.2 = 3.6\\\\r^{2}= \frac{3.6*3}{3.14*4.2}\\\\ = 0.81\\r=\sqrt{0.81}\\\\[/tex]

r = 0.9 in

Answer:

.... ..................

3/14 x 2/12 multiply then simplify

Answers

Answer:

1/28

Step-by-step explanation:

6/168=1/28

Answer:

hi

Step-by-step explanation:

I think so...

[tex] \frac{3}{14} \times \frac{2}{12} = \frac{1}{7} \times \frac{1}{4} = \frac{1}{28} [/tex]

hope it helps

have a nice day

Solve the system of equations.
2x + 3y = 13
-6x + 4y = 0
A. (2,3)
B.1/2,4
C. (5, 1)
D. (-2, -3)

Answers

Answer:

Step-by-step explanation:

The answer is A for both

Answer:

multiply equation 1by -3 and multiply equation 2 by 1

-3×2x+3y×-3=13×-3

-6x+4y=0

-6x-9y=-39

-6x+4y=0

Step-by-step explanation:

-13y=-39

divide both side by -13

-13y/-13=-39/-13

y=3

put answer of y in equation 1

2x+3y=13

2x+3×3=13

2x+9=13

take like terms of the equation

2x=13-9

2x=4

divide both side by 2

2x/2=4\2

x=2

(x,y)=(2,3)

If the principal is $200 and the interest rate is 4 percent, what is the simple interest earned in one year?
А.$8
B.$50
C.$800

Answers

Answer:

A

Step-by-step explanation:

what is the lateral of a cone with 10 yd and 12.1 yd

Answers

Answer:

190.07 yd²

Step-by-step explanation:

Given that :

Base of cone = 10 yards

Height of cone = 12.1 yards

The lateral area of a cone is obtained using the relation :

π × r * l

Where r = Radius = base / 2

l = height of cone

Radius, r = 10/ 2 = 5 yards

Lateral area = π * 5 * 12.1

Lateral area = 190. 0666

Lateral area = 190.07 yd²

Rectangle VWXY is dilated by a scale factor of 2/3 to form rectangle V'W'X'Y’. Side VW
measures 21. What is the measure of side V'W'?

Answers

Answer:

y

Step-by-step explanation:

Answer:

V'W' = 14

Steps:

V'W' = VW×2/3

V'W' = 21×2/3

V'W' = 42/3

V'W' = 14

Elizabeth bought snacks for her team's practice. She bought a bag of apples for $3.41
and a 10-pack of juice bottles. The total cost before tax was $13.21. Write and solve an
equation which can be used to determine j, how much each bottle of juice costs?

Answers

Answer:

$9.80

Step-by-step explanation:

$13.21 - $3.41 = $9.80

Answer:$5.49

Step-by-step explanation:

   

In this combined function, the domain is all real numbers for x except?( x-2) / (x+5)

-2
2
-5
5

Answers

-5 because the denominator can’t equal zero

(factoring polinonomials) help help help help help help please:(((​

Answers

I think it’s b sorry if I’m wrong

Can someone please help me! i’m confused!

Answers

Answer:

i am so sorry about it

its difficult

Me.Bernstein will cut 8 pies into pieces that are each 1/6 of the whole After he cuts the 8 pies. how many pieces will Mr.Bernstein have

Answers

9514 1404 393

Answer:

  48

Step-by-step explanation:

If each piece is 1/6 of the whole pie, then the whole pie has been divided into 6 equal pieces. The number of pieces resulting from 8 pies being cut that way is ...

  (8 pies)(6 pieces/pie) = 8×6 pieces = 48 pieces

Erick bought a game for $9.78, a toy for $6.34, and a sandwich for $4.91. If he started with $30, about how much money does he have left

Answers

Answer: $ 8.97

Step-by-step explanation:

Game =$9.78

toy=$ 6.34

sandwich =$4.91

Total amount  spent=$9.78+$6.34+$4.91=>  $21.03

Total amount=$30

left amount=total amount- amount spent

=   $30-&21.03

 =$8.97


Johnny Appleseed was creating a fractal tree design:


The first tree, (a1), only has 1 leaf (the green point). The second tree, (a2), has leaves. The third tree, (a3), has 7 total leaves. How many total leaves will be on the 7th tree?
a) 63
b) 127
c) 128
d) 256

Answers

Is b jsjsj nsjsjaknajdudiensjkalaljs

Answer:

The total leaves on the 7th tree is, 127.

Explanation:

Definition of sequence and series:

A sequence is defined as a set of integers arranged in a specific order. A series, on the other hand, is defined as the sum of a sequence's elements.

Step by step:

The total leave will be on  7th tree are calculated.

Multiply term 2 and add term 1, to get the next digit.

According, to the question:

[tex]1[/tex]×[tex]2+1=3[/tex]

[tex]3[/tex]×[tex]2+1=7[/tex]

[tex]7[/tex]×[tex]2+1=15[/tex]

[tex]15[/tex]×[tex]2+1=31[/tex]

[tex]31[/tex]×[tex]2+1=63[/tex]

[tex]63[/tex]×[tex]2+1=127[/tex]

Hence, the 7th tree will have a total of 127 leaves.

To know more about sequence and series here, https://brainly.com/question/7882626

#SPJ2

Guys please help i dont understand im bad at math

Answers

The first on is B and the second one is C
first one is b and the other is d

I need help if right I will mark you as brainlest

Answers

Answer:

More than 275 dollars of here budget goes to emergencies

Step-by-step explanation:

11% of 2750 is $302.50

Ryan exponential function of the form f(t)= a×b^t to represent the following situation. assume t is in years. an account has an initial investment of $91,000, increasing by 3.76% per year. F(T)=_________​

Answers

Answer

[tex]f(t) = 91000 *1.0376^t[/tex]

Explanation

Given

[tex]a = 91000[/tex] -- initial

[tex]r = 3.76\%[/tex]

Required

The exponential equation

The exponential equation is:

[tex]y =ab^t[/tex]

Where

[tex]b=1 +r[/tex]

We used minus, because the rate increases..

So, we have:

[tex]b=1 +3.76\%[/tex]

[tex]b=1 +0.0376[/tex]

[tex]b=1.0376[/tex]

So:

[tex]y =ab^t[/tex]

[tex]y = 91000 *1.0376^t[/tex]

Hence:

[tex]f(t) = 91000 *1.0376^t[/tex]

Find the (a) mean, (b) variance, and (c) standard deviation of the binomial distribution for the given random variable, and (d) interpret the results. Sixty-three percent of U.S. mothers with school-age children choose fast food as a dining option for their families one to three times a week. You randomly select five U.S. mothers with school-age children and ask whether they choose fast food as a dining option for their families one to three times a week. The random variable represents the number of U.S. mothers who choose fast food as a dining option for their families one to three times a week.

Answers

Answer:

a) The mean is 3.15.

b) The variance is 1.1655.

c) The standard deviation is 1.08.

d) The expected number of families in the sample who choose fast food as a dining option for their families one to three times a week is 3.15. The variance of 1.1655 and the standard deviation of 1.08 are the averages from which the sample results should diverge from the mean.

Step-by-step explanation:

Binomial probability distribution

Probability of exactly x sucesses on n repeated trials, with p probability.

The expected value of the binomial distribution is:

[tex]E(X) = np[/tex]

The variance of the binomial distribution is:

[tex]V(X) = np(1-p)[/tex]

The standard deviation of the binomial distribution is:

[tex]\sqrt{V(X)} = \sqrt{np(1-p)}[/tex]

Sixty-three percent of U.S. mothers with school-age children choose fast food as a dining option for their families one to three times a week.

This means that [tex]p = 0.63[/tex]

You randomly select five U.S. mothers with school-age children and ask whether they choose fast food as a dining option for their families one to three times a week.

This means that [tex]n = 5[/tex]

(a) mean

[tex]E(X) = np = 5*0.63 = 3.15[/tex]

The mean is 3.15.

(b) variance

[tex]V(X) = np(1-p) = 5*0.63*0.37 = 1.1655[/tex]

The variance is 1.1655.

(c) standard deviation

[tex]\sqrt{V(X)} = \sqrt{np(1-p)} = \sqrt{5*0.63*0.37} = 1.08[/tex]

The standard deviation is 1.08.

(d) interpret the results.

The expected number of families in the sample who choose fast food as a dining option for their families one to three times a week is 3.15. The variance of 1.1655 and the standard deviation of 1.08 are the averages from which the sample results should diverge from the mean.

PLEASE HELP ASAP!!! WILL MAKE YOU THE BRAINLYIST!!!!
Assume this dance floor is 20 feet long and 30 feet wide. How many people will fit on this dance floor if you assume each person will dance in a space that is 2 feet wide and 2 feet long?

Answers

15 ppl would fit

Bc if you find the area of the dance floor which is 20 feet times 30 feet it equals 60 feet. Then multiply how much space someone takes which is 2 feet times 2 feet equals 4 feet. Then you divide the area of the dance floor by the number for F space one person takes up which is 60÷4. You would get 15 people

the box and whisker plot below shows the volunteer service hours performed by students at indian trail middle school last summer

Answers

Answer:

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

circuit compare

with the current in a series circuit, if both circuits have the same

type of cell and the same number of identical flashlight bulbs?

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is Choose...128136153258 in².

What is the area of this figure?

Drag and drop the appropriate number into the box.

A = 

What is the area of this figure?

Drag and drop the appropriate number into the box.

What is the area of this figure?

Drag and drop the appropriate number into the box.

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is Choose...128136153258 in².

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is Choose...128136153258 in².

What is the area of this figure?

Drag and drop the appropriate number into the box.

A = 

What is the area of this figure?

Drag and drop the appropriate number into the box.

What is the area of this figure?

Drag and drop the appropriate number into the box.

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is

What is the area of this figure?

Select from the drop-down menu to correctly complete the statement.

The area of the figure is Choose...128136153258 in².

What is the area of this figure?

Drag and drop the appropriate number into the box.

Given the system which is true? Thanks in advance!

Answers

Answer: the system has no solution

Step-by-step explanation:

The slope and the y-intercept is different

Find the diameter of the circle with the given circumference. Use 3.14 for π(PI). C=22 cm

Answers

the answer is 7.006
Answer: 14.01274
Explanation: The formula of the diameter of a circle is 2xradius. We only have the Circumference so we divide 22 by pi which is 7.00637. After that we multiply the radius (7.00637) by 2 which gives us 14.01274. If you round it is equal to 14.0

Xander needs to collect at least 120 cans for a food drive to earn community service credit. He has already collected 64 items.

Part A
Choose the inequality and solution to represent the number of cans, x, that Xander must still collect.
a x + 64 ≤ 120; x ≤ 56
b x + 120 ≤ 64; x ≤ –56
c x + 64 ≥ 120; x ≥ 56
d x + 120 ≥ 64; x ≥ –56

Answers

Answer:

b

Step-by-step explanation:

The question I’m trying to figure out is What is y?

Answers

Answer:

y = 136

Step-by-step explanation:

x + 54 + 82 = 180

x + 136 = 180

x = 44

x + y = 180

44 + y = 180

y = 180 - 44

y = 136

Other Questions
This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI How can I get my SSS verification slip online? What were the goals of the US in Afghanistan? What are 3 interesting facts about the Taj Mahal? identify the conclusions that can be drawn from the given premises using existential generalization. (check all that apply.)Check All That Apply a. There exists a non-six-legged creature that eats a six-legged creature. b. There does not exist a non-six-legged creature that eats a six-legged creature. c. There exists a noninsect that eats an insect d. There does not exist a noninsect that eats an insect. if you are in a low-speed collision, when your vehicle is repaired, be sure to have your replaced. Who described the flow of blood through the heart? [tex](5-\sqrt{5}) and (\sqrt{5} -5)[/tex]Are two roots of a fourth degree polynomial with integer coefficients, what are the other roots? Why do we need to be worried about chemical safety? Which type of nutrient helps maintain healthy skin and hair?A) carbohydrateB) proteinC) fatD) starch