GIVING BRAINLIEST!!!!!!

Explorers __________ and __________ set out to explore the land that was gained in the Louisiana Purchase.

Answers

Answer 1
Lewis and Clark
They were sent by president Thomas!!

Related Questions

Answer this asap






This is social studies.




:)))

Answers

Answer: Against mexican war

Explanation: Due to "the people" not wanting to steal from Natives anymore.

Answer:

yes it is

Explanation:

because that was back  in  the past

In the stanford prison experiment, "john wayne" was able to take on "the role of the other," who in this case represents the prisoners?

Answers

In the Stanford Prison Experiment, "John Wayne" was able to take on "the role of the other," who in this case represents the prisoners? is True.

Indeed, in the Stanford Prison Experiment, "John Wayne" (a pseudonym used by one of the participants) was able to assume "the role of the other," which in this case represented the prisoners.

The Stanford Prison Experiment was a renowned social psychology study conducted in 1971 at Stanford University.

Led by Philip Zimbardo, the experiment aimed to examine the psychological effects of perceived power in a simulated prison environment.

Participants were randomly assigned as either prisoners or guards and were placed in a mock prison setting.

Remarkably, the participants swiftly embraced their assigned roles, with the guards exhibiting authoritarian behavior and the prisoners adapting to their submissive positions.

"John Wayne" was one of the participants who successfully embodied the role of a prisoner, displaying the characteristics and behaviors associated with that role.

However, the experiment had to be prematurely terminated after just six days instead of the planned two weeks due to the extreme and disturbing behaviors exhibited by the guards, who became increasingly sadistic, and the deterioration of the mental well-being of the prisoners.

The study remains a significant and controversial example of the powerful influence of social roles on human behavior.

Therefore, In the Stanford Prison Experiment, "John Wayne" was able to take on "the role of the other," who in this case represents the prisoners? is True.

Read more about prisoners

https://brainly.com/question/30649489

#SPJ11

Do you think nixon's resignation was a sign that the american system of government was broken, or was it a sign that government and its systems were working?

Answers

The resignation of Nixon as president of the United States was a sign that the American system of government was working.

Richard Nixon, who became president of the United States in 1969, faced many problems throughout his presidency. He faced a lot of opposition and criticism because of the Watergate scandal in 1972.

The Watergate scandal was a political scandal that arose after a break-in at the Democratic National Committee (DNC) headquarters at the Watergate Office complex in Washington, D.C. on June 17, 1972. After that, Nixon was accused of covering up the crime.

The incident led to the formation of the Senate Select Committee on Presidential Campaign Activities, which began hearings on the case in May 1973. Nixon was forced to resign as president on August 8, 1974, after his role in the Watergate scandal became public

Learn more about Watergate Scandal at:

https://brainly.com/question/16183991

#SPJ11

In regards to government initiatives to support and increase diversity, which of the following is not true: Select one: a. Implement policies to improve opportunities for men. b. Need to implement effective legislation prohibiting discrimination and encouraging employment. c. Take action to improve the education of non-dominant group members. d. Erase the digital divide between races and classes.

Answers

The correct answer is A) Implement policies to improve opportunities for men.

In regards to government initiatives to support and increase diversity, what is not true is "Implement policies to improve opportunities for men."

Diversity means opening the door to all genders, forms of thinking, ethnicities, races, cultures, and nationalities.

That is why diversity initiatives can be the following. The need to implement effective legislation prohibiting discrimination and encouraging employment. To take action to improve the education of non-dominant group members. To erase the digital divide between races and classes.

These actions prove that society is diverse and welcomes all of those that are not traditional and does not criticizes or judges what is not familiar to it.

To be diverse means to have respect and tolerance for different ways of thinking and doing things. Today's world needs more open people willing to accept diversity in the workplace and society in general.

1. Water is a scarce resource in the Middle East?

Answers

Answer:

yes

Explanation:

Answer:

water

Explanation:

they do not have water

Identify free types of Greek columns and describe one characteristic of each.

Answers

Answer:

I really hope you mean three columns, I'm gonna do my best.

Explanation:

Doric columns are the oldest kind of column and are very plain.

Ionic columns have a scroll pattern on the top.

Corinthian columns have elaborate designs at the top.

The three types of Greek columns are Doric, Ionic, and Corinthian.

What are the characteristics of Greek Ionic columns?

Since the Ionic column is usually thinner than the Doric, it must have a base: In the Antebellum colonnades of late American Greek Revival plantation homes, Ionic columns stand eight to nine column diameters tall, sometimes even higher. Most frequently, ionic columns have flutes.

The Doric column is the oldest and simplest of the three types. It has a plain, fluted shaft with no base and a simple, squared capital. The column is wider at the bottom than at the top and has a heavy, sturdy appearance. One characteristic of the Doric column is that it is typically used in more masculine or austere architectural styles, such as military buildings or government buildings.

The Corinthian column is the most ornate and decorative of the three types. It has a slender, fluted shaft with a base that is similar to the Ionic, but with more elaborate details. The capital of the Corinthian column is decorated with acanthus leaves and small scrolls, giving it a very decorative appearance. One characteristic of the Corinthian column is that it is often used in more elaborate or grandiose architectural styles, such as palaces, mansions, or public buildings designed to impress.

Learn more about Greek Ionic columns here:

https://brainly.com/question/15576304

#SPJ2

HELP
PLS DO NOT PUT ANY LINKS
Research an entrepreneur of your choice using safesearch.com or kiddle.co.

You will submit the Online Entrepreneur Profile Template. The link for this is on the last slide of Module 6.02.

This should look like a social media page that has information about your chosen entrepreneur. In your profile, be sure to include the following facts about your entrepreneur:

personal background
the business idea
motivations and incentives to start the business
how the entrepreneur kept the business competitive
how the business has grown and spread to more people

Answers

Answer:

we kinda need the link to do the question

Explanation:

describe a demonstration to compare and contrast the foot or shoe with no steps.

Answers

The foot or shoe with no steps can be compared and contrasted through a demonstration highlighting their functionality, stability, impact absorption, and freedom of movement.

The demonstration can include showcasing the foot's functionality in activities like walking, running, and balancing, highlighting its adaptability and natural cushioning. Contrasting this with the shoe with no steps, we can discuss its limited functionality and reduced stability without a sole.

Additionally, we can demonstrate the foot's ability to absorb impact through small jumps or steps, contrasting it with the shoe's lack of cushioning. Finally, by showcasing the foot's flexibility and freedom of movement, we can contrast it with the restricted movement when wearing a shoe without a sole.

To know more about shoe , click here.

https://brainly.com/question/13869621

#SPJ4

If east and west germany had no unified it is most likey that: ______

Answers

If East and West Germany had not unified, it is most likely that the two states would still exist as separate entities. Following World War II, Germany was split into two countries, with the eastern half being occupied by Soviet forces and the western half by a combination of American, British, and French forces.

This separation was formalized with the establishment of the Federal Republic of Germany (West Germany) and the German Democratic Republic (East Germany) in 1949.Both countries operated independently, with different political systems, economic structures, and societal values. The border between East and West Germany was heavily fortified, with walls, fences, and armed guards, making travel and communication between the two states difficult and dangerous. The division between the two countries persisted for over four decades, until the fall of the Berlin Wall in 1989 and the subsequent reunification of Germany in 1990.

German reunification (German: Deutsche Wiedervereinigung) was the process of re-establishing Germany as a single full sovereign state, which took place between 9 November 1989 and 15 March 1991. The day of 3 October 1990 when the "Unification Treaty" entered into force dissolving the German Democratic Republic (GDR; German: Deutsche Demokratische Republik, DDR, or East Germany) and integrating its recently re-established constituent federated states into the Federal Republic of Germany (FRG; German: Bundesrepublik Deutschland, BRD, or West Germany) to form present-day Germany, has been chosen as the customary German Unity Day (Tag der deutschen Einheit) and has thereafter been celebrated each year as a national holiday in Germany since 1991.[1] As part of the reunification, East and West Berlin of the two countries were also de facto united into a single city; which later eventually became the capital of this country.

To know more about unified, visit:

https://brainly.com/question/29684293

#SPJ11

Let time Y in years present the time before a major repair is required for a certain washing machine. Assume Y follows exponential distribution with a mean 5 years. (a) The machine is considered a bargain if it is unlikely to require a major repair before the sixth year. What's the probability that no major repair is needed before the sixth year? (b) What is the probability that a major repair is required in the first year? (c) Suppose after the repair, the washing machine is considered as a "new" one. It may require another major repair after some random time, which follows the same exponential distribution. Given a time duration of 10 years, what is the probability that this washing machine is repaired for twice?

Answers

(a) The probability of no major repair before the sixth year is [tex]1 - e^(-6/5)[/tex].(b) The probability of a major repair in the first year is [tex](1/5) * e^(-1/5)[/tex].

(c) The probability of the washing machine being repaired twice within a 10-year duration is [tex](1/5) * e^(-5/5)[/tex].

(a) To find the probability that no major repair is needed before the sixth year, we need to calculate the cumulative distribution function (CDF) of the exponential distribution with a mean of 5 years at the sixth year.

The formula for the CDF of the exponential distribution is given by[tex]P(Y \leq y) = 1 - e^(-y/\mu)[/tex], where y is the time duration and μ is the mean.

In this case, y = 6 years and μ = 5 years. Plugging these values into the formula, we get:

[tex]P(Y \leq 6) = 1 - e^(-6/5)[/tex]

(b) To find the probability that a major repair is required in the first year, we need to calculate the probability density function (PDF) of the exponential distribution at the first year. The PDF of the exponential distribution is given by[tex]f(y) = (1/\mu) * e^(-y/\mu).[/tex]

In this case, y = 1 year and μ = 5 years. Plugging these values into the formula, we get:

[tex]f(1) = (1/5) * e^(-1/5)[/tex]

(c) Given a time duration of 10 years, we want to find the probability that the washing machine is repaired twice.

Since the time between repairs also follows an exponential distribution with a mean of 5 years, we can use the memorylessness property of the exponential distribution.

The probability that the washing machine is repaired twice within a 10-year duration is equal to the probability of a major repair occurring in the first 5 years, which can be calculated using the PDF of the exponential distribution.

In this case, y = 5 years and μ = 5 years. Plugging these values into the formula, we get:

[tex]f(5) = (1/5) * e^(-5/5)[/tex]

Learn more about probability :

brainly.com/question/30034780

#SPJ4

True or false True or false 31. The government component of GDP includes salaries paid to Army generals but not Social Security benefits to the elderly 32. An increase in the saving rate does not permanently increases the growth rate of real GDP per person 33.In ten years when you are the owner of a major U.S.corporation,if your corporation opens and operates a branch in a foreign country you will be engaging in foreign direct investment. 34. Corporations receive no proceeds from the resale of their stock 35. According to the rule of 70,if you earn an interest rate of 3.5 percent,your savings will double about every 20 years 36. The value of a stock depends on the ability of the company to generate dividends and the expected price of the stock when the stockholder sells her shares. 37.A minimum wage above equilibrium creates a labor surplus 38. According to the theory of efficiency wages,firms operate more efficiently if they can pay wages that are below the equilibrium level. 39. The use of money allows trade to be roundabout. 40. The quantity theory of money can explain hyperinflations but not moderate inflation

Answers

31. The given statement, "The government component of GDP includes salaries paid to Army generals but not Social Security benefits to the elderly," is true (T) because the salaries paid to Army generals are considered government expenditures and are included in the government component of GDP, while Social Security benefits are considered transfers and not included in GDP.

32. The given statement, "An increase in the saving rate does not permanently increases the growth rate of real GDP per person," is false (F) because an increase in the saving rate can lead to higher investment and capital accumulation, which can contribute to long-term economic growth and an increase in real GDP per person.

33. The given statement, "In ten years when you are the owner of a major U.S. corporation, if your corporation opens and operates a branch in a foreign country you will be engaging in foreign direct investment," is true (T) because Opening and operating a branch in a foreign country would qualify as foreign direct investment (FDI), as it involves a significant and lasting investment in a foreign economy.

34. The given statement, "Corporations receive no proceeds from the resale of their stock," is true (T) because Corporations do not receive any proceeds from the resale of their stock since the stock represents ownership in the company and the transactions occur between investors in the secondary market.

35. The given statement, "According to the rule of 70,if you earn an interest rate of 3.5 percent,your savings will double about every 20 years," is true (T) because according to the rule of 70, dividing the number 70 by the interest rate (3.5%) approximates the number of years it takes for savings to double, which is approximately 20 years in this case.

36. The given statement, "The value of a stock depends on the ability of the company to generate dividends and the expected price of the stock when the stockholder sells her shares," is true (T) because the value of a stock is influenced by the company's ability to generate dividends, which provide a direct return to stockholders, and the expected future price of the stock when the stockholder decides to sell their shares.

37. The given statement, "A minimum wage above equilibrium creates a labor surplus," is true (T) because when the minimum wage is set above the equilibrium wage, it creates an artificial floor for wages, resulting in a surplus of labor as more people are willing to work at the higher wage than there are job opportunities available.

38. The given statement, "According to the theory of efficiency wages, firms operate more efficiently if they can pay wages that are below the equilibrium level," is false (F) because according to the theory of efficiency wages, firms can operate more efficiently by paying wages above the equilibrium level, as higher wages can motivate workers, reduce turnover, and improve productivity.

39. The given statement, "The use of money allows trade to be roundabout," is true (T) because money facilitates indirect exchange and enables trade to be conducted without the need for a double coincidence of wants, making transactions more efficient and enabling specialization and economic growth.

40. The given statement, "The quantity theory of money can explain hyperinflations but not moderate inflation," is false (F) because the quantity theory of money can explain moderate inflation as well as hyperinflations.

In general, the government component of GDP includes the salaries paid to Army generals but not Social Security benefits to the elderly because government expenditures on goods and services are considered as part of GDP. Salaries paid to Army generals fall under government spending as they are payments for the services provided by government employees.

However, Social Security benefits are classified as transfer payments because they involve the redistribution of income from one group (taxpayers) to another (elderly recipients), without any corresponding production of goods or services. Transfer payments, such as Social Security benefits, are not included in GDP calculations because they do not represent current production.

An increase in the saving rate does not permanently increase the growth rate of real GDP per person. While a higher saving rate can contribute to increased investment and capital accumulation in the short term, leading to a temporary boost in GDP growth, sustained and long-term economic growth primarily depends on productivity improvements, technological advancements, and structural factors.

Simply increasing the saving rate does not guarantee a permanent increase in the growth rate of real GDP per person. Other factors, such as improvements in human capital, innovation, and institutional factors, play crucial roles in driving sustainable economic growth.

Learn more about real GDP: https://brainly.com/question/17110800

#SPJ11

American Indians carried their tepees with them as they traveled the plains explain how these were similar to a pioneer's covered wagon.

Answers

Answer: Because the pioneer's wagons had covers to them too, so the people could sleep in their wagons, and cary it around with them similar to how Indians carry their tepees with them intended to sleep in

Explanation:

1) An airline charges a large person twice as much for a ticket because the person needs two seats 2) An airline charges last minute travelers a higher price to travel between two cities than people who bought their tickets three weeks in advance.
3) A movie theater gives my child a student discount when I take him to the movies.
4) A movie theater charges a lower price for matinee tickets that evening tickets
The best answer is
A. Only 2 and 3 are examples of price discrimination B.Only and examples of price discrimination C. Only 2 1 and 4 are examples of price discrimination
D. Only 1 and 4 are examples of price discrimination
E. No other answer is correct

Answers

An airline charges a large person twice as much for a ticket because the person needs two seats, an airline charges last minute travelers a higher price to travel between two cities than people who bought their tickets three weeks in advance, and a movie theater charges a lower price for matinee tickets that evening tickets is an example of price discrimination. Option c is correct.

Price discrimination refers to the practice of charging different prices for the same product or service based on various factors such as customer characteristics, time of purchase, or demand elasticity.

In option 2, the airline charges last-minute travelers a higher price compared to those who bought tickets in advance. This is an example of price discrimination based on the timing of purchase.

Option 1 describes the airline charging a large person twice as much because they need two seats. This is an example of price discrimination based on customer characteristics.

Option 4 mentions the movie theater charging a lower price for matinee tickets compared to evening tickets. This is an example of price discrimination based on the timing of the movie showings.

Thus, the correct option is C.

Learn more about price discrimination https://brainly.com/question/14977468

#SPJ11

3. hamilton thinks that the profitability of the firm to the owners has been hurt by white’s reluctance to use much interest bearing debt. is this a reasonable position? why?

Answers

Hamilton thinks that the profitability of the firm to the owners has been hurt by White’s reluctance to use much interest-bearing debt. Yes, Hamilton's position is reasonable because interest-bearing debt is a type of financing that businesses use to acquire cash.

When the owners pay interest, it eats away at the company's profit. Investment and financing decisions of a company can have an impact on its profitability. Interest-bearing debt is one of the methods for financing a company. When a company takes on debt, they are basically taking on a liability to repay the debt with an additional amount of interest. Profitability is the money a company earns after paying all its expenses. Higher profitability is always desirable as it signifies that a company is more successful in generating income relative to the expenses incurred.

To maximize their profitability, companies must find a balance between the debt they acquire and the interest they must pay on it. Too much debt may cause cash flow problems, while too little debt may lead to missed opportunities to invest in growth or improve profitability. Therefore, Hamilton's position that the company's profitability is affected by White's reluctance to use much interest-bearing debt is reasonable.

To know more about profitability :

https://brainly.com/question/1078746

#SPJ11

which exemplifies a nuclear family? group of answer choices first- and second-degree relatives who live in the same neighborhood individuals who are not blood relatives but share a common locale of origin or culture first- and second-degree relatives who live together first-degree relatives who live together

Answers

First-degree relatives are related by blood and include biological parents, children, and siblings. A nuclear family is made up of parents and their children who live together under one roof, therefore the answer to the given question is "First-degree relatives who live together.

"In a nuclear family, the roles of mother and father are fulfilled by two parents who are legally married or cohabiting and raising their children in the same household. These parents are responsible for providing for their children and ensuring that they are safe and healthy. Children in a nuclear family are typically raised by their parents, but may also be cared for by other family members or caregivers if both parents are working or have other obligations. In a nuclear family, the emphasis is on the immediate family unit, and the relationships between family members are prioritized above other relationships.

A nuclear family exemplifies first-degree relatives who live together.

know more about nuclear family.

https://brainly.com/question/1037819

#SPJ11

During training sessions, a trainer uses behavior modification by dispensing rewards such as praise to positively reinforce behaviors. (T/F).

Answers

True. During training sessions, a trainer often employs behavior modification techniques that involve the use of rewards, such as praise, to positively reinforce desired behaviors. This approach is based on the principles of operant conditioning and aims to increase the likelihood of those behaviors being repeated in the future.

Positive reinforcement is a fundamental aspect of behavior modification. When a desired behavior is exhibited, the trainer provides a reward, such as verbal praise or other forms of recognition, to reinforce that behavior. By associating the behavior with a positive outcome, the individual is motivated to continue engaging in that behavior. Praise can be a powerful tool in shaping behavior as it not only provides immediate reinforcement but also promotes a positive learning environment. It helps to build confidence, self-esteem, and motivation in the individual being trained. Additionally, praise can be combined with other types of rewards, such as tangible incentives or privileges, to further reinforce desired behaviors.

Learn more about Positive reinforcement here:

brainly.com/question/30788120

#SPJ11

Why do you think countries choose to have a form of government

Answers

Answer:

Without government, there would just be chaos. No rules or anything and no right of passage.

what do you mean by 3R ? social

Answers

Answer:

The three R's – reduce, reuse and recycle – all help to cut down on the amount of waste we throw away. They conserve natural resources, landfill space and energy. Plus, the three R's save land and money communities must use to dispose of waste in landfills.

Explanation:

What do you think the environment of encouragement and support is important at home?​

Answers

Answer:

A positive home environment is one that supports your lifestyle and consider what sorts of things cause friction between family members or add frustration to your life and look for solutions, and support is important at home is encouragament by your parents.

Explanation:

The environment of encouragement and support is important at home are positive environment was the creation of the good human being.

What is environment?

The term environment refers to the surrounding on earth. The environment based on living and non-living thing. The environment effect on human life. The biotic elements of the environment are plants, fisheries, animals, forests, and bacteria. The abiotic elements are water, land, rocks, air etc.

A healthy home environment is one that promotes your lifestyle and considers what kinds of things generate conflict amongst family members or add irritation to your life and looks for solutions, and encouragement from your parents is crucial at home. The excellent human being was created by a positive atmosphere.

As a result, the environment of encouragement and support is important at home are positive environment was the creation of the good human being.

Learn more about on environment, here:

https://brainly.com/question/13107711

#SPJ2

which of the following is not a type of inventory? part 2 a. work-in-process b. raw material c. finished goods d. mrp

Answers

d) MRP ( Material Requirements Planning) is not a type of inventory but a planning system for managing raw materials and components in production processes.

The option that is not a type of inventory is:

d. MRP (Material Requirements Planning). MRP is not a type of inventory but rather a planning and control system used in manufacturing and production processes.

It helps manage the procurement and scheduling of raw materials and components needed for production. MRP calculates the necessary quantities and timing of materials, but it does not represent an actual physical inventory category.

On the other hand, work-in-process, raw material, and finished goods are all distinct types of inventory commonly found in manufacturing and supply chain operations, representing different stages and forms of goods within the production process.

To know more about Material Requirements Planning :

https://brainly.com/question/30880668

#SPJ4

____________ is an example of which type of question? a. closed ended question b. open ended question c. matrix question d. contingency question

Answers

Closed ended question is an example of which type of question.

The answer is the letter a. Closed ended question.

What is a closed-ended question?

Closed-ended questions are commonly utilized in research, polling, and surveying. They are usually a yes or no question or a multiple-choice question. A closed-ended question is a question that has a fixed number of potential responses

A closed-ended question, often known as a multiple-choice question, limits the answer to a set of possibilities. Because these questions limit the range of possible responses, they are often utilized in polls and surveys where data collection should be speedy, precise, and simple.

Learn more about type of question at:

https://brainly.com/question/15737887

#SPJ11

Choose the example that matches the value the example explains. I can have a tattoo on my face if I choose. Directness I can greet both my friends and my professors with the word 'hi'. [Choose] My job isn't interesting anymore. I think I'll get a new one. [Choose ] I conquered Mt. Everest! Competition I have a meeting at 6:00 and will need to be at dinner by 7:00. Time and its control Future orientation Next year I will travel to England and in two years I will travel to Japan. I already bought tickets! Just tell me what I need to know. [Choose] Our factory just got new sewing machines. We can now process 20 quilts an hour instead of 10. Efficiency I can't wait for Black Friday! I'll get so many good deals at the mall! [Choose ] [Choose] The U.S. has a number of antitrust laws so that no one company can have a monopoly on an industry.

Answers

The example that matches the value of the example that explains the value of competition is: "I conquered Mt. Everest!"

Competition is a value that refers to the act of competing or striving for a goal that can be achieved or obtained. It is defined as an act of engaging in a competitive rivalry or contest to achieve success or to be recognized. An example that matches the value of competition is "I conquered Mt. Everest!" because this statement indicates that someone competed against the highest mountain in the world to achieve success. It demonstrates that the person was determined, focused, and motivated to conquer the challenge despite the risks. Conquering Mt. Everest is a competition because it involves physical and mental challenges, including altitude sickness, freezing temperatures, and steep terrain, that need to be overcome to reach the summit.

Learn more about Competition: https://brainly.com/question/30109636

#SPJ11

Research shows community violence ____________ students in school and classroom settings.

Answers

Research shows that community violence negatively affects students in school and classroom settings.

Exposure to community violence has been found to have a profound impact on students' well-being and academic performance. When students witness or experience violence in their neighborhoods or communities, it can create a range of physical, emotional, and psychological challenges that directly influence their ability to engage and succeed in school. The effects of community violence on students can be far-reaching. They may experience symptoms of trauma, such as anxiety, depression, and post-traumatic stress disorder (PTSD), which can significantly impact their concentration, motivation, and overall mental health. The constant fear and insecurity stemming from community violence can also disrupt students' sense of safety and belonging, making it difficult for them to focus on their studies and establish positive relationships with peers and teachers. Moreover, community violence can lead to a pervasive culture of aggression and conflict, which can spill over into the school environment. Students who are exposed to violence may be more likely to engage in aggressive behaviors themselves, leading to disruptions in the classroom and hindering the learning process for all students. To address the impact of community violence on students, it is crucial for schools and educators to create safe and supportive environments that promote healing, resilience, and social-emotional well-being. This can involve implementing trauma-informed practices, providing counseling and support services, fostering positive relationships, and actively involving the community in violence prevention efforts.

Learn more about community:

brainly.com/question/29811467

#SPJ11

Explain what happened in the kansas nebraska act

Answers

Answer:

well

Explanation:

It became law on May 30, 1854. The Kansas-Nebraska Act repealed the Missouri Compromise, created two new territories, and allowed for popular sovereignty. It also produced a violent uprising known as “Bleeding Kansas,” as proslavery and antislavery activists flooded into the territories to sway the vote.

An action that an animal does in order to survive is known as - *

physical adaptation
behavioral adaptation
genetic variation
genetic adaptation

Answers

Answer:

Genetic Adaption

Explanation:

Genetic Adaption is an action that a animal does in order to survive

In the following statement:
class Car protected Vehicle
.....is the derived class.
Car
Vehicle
Protected
Cannot be determined
None of these

Answers

Car is the derived class in the given statement. Therefore, the correct option is (a) Car.

In the given statement, the derived class is "Car." In object-oriented programming, a derived class (also known as a subclass or child class) inherits properties and behaviors from a base class (also known as a superclass or parent class).In this case, "Car" is mentioned after the keyword "class," indicating that it is the derived class. "Vehicle" is mentioned after the keyword "protected",  which is an access modifier used to specify the visibility of class members within the class and its subclasses. However, the presence of "Vehicle" alone does not determine whether it is the derived class or the base class.

Therefore, based on the given statement, the derived class is "Car".

For more such questions on Derived class:

https://brainly.com/question/29975727

#SPJ8

what is the central idea of this excerpt the ruthlessness of power

Answers

The central idea of the excerpt is the ruthlessness of power. This suggests that when individuals or groups possess power, they often act in a harsh and merciless manner, disregarding the well-being and rights of others.

The excerpt implies that power can corrupt individuals, leading them to prioritize their own interests and desires above the needs and rights of those they govern or influence. It highlights the tendency for power to be wielded without empathy or consideration for the consequences, resulting in the oppression, exploitation, or mistreatment of others. The central idea emphasizes the inherent dangers of unchecked power and serves as a cautionary reminder of the potential harm that can be inflicted when power is misused or abused.

To learn more about Ruthlessness of power: brainly.com/question/30188998

#SPJ11

If you are asked a question to which you don't know the answer, the proper response should be:
a. "I'm afraid I will not be able to answer your queries."
b. "Shall we keep the questions toward the end of the session?"
c. "I don't know the answer but I will research it and get back to you"
d. "This seems to digress from the topic in discussion."
e. "Questioners should ensure that they benefit the entire audience."

Answers

If you are asked a question to which you don't know the answer, the proper response should be I don't know the answer but I will research it and get back to you. The Option C.

How should you respond when you don't know the answer?

When faced with a question to which you don't know the answer, it is appropriate to honestly admit lack of knowledge while assuring person that you will make an effort to find the information they seek.

By responding with this, we acknowledge the gap in  knowledge but express willingness to research the topic and provide a more informed response in the future. This approach demonstrates integrity and commitment to providing accurate information.

Read more about unknown

brainly.com/question/30369925

#SPJ1

Suppose that the rulers of Sparta have asked your advice. Think about the reasons for and against helping Athens. Then Write a letter to the ruler explaining what you think Sparta should do. State the pros and cons clearly

Answers

Dear.

Through this letter, I humbly respond to your request regarding my opinion regarding whether or not to help the city of Athens. I believe that we must help and that this will be very beneficial for all Sparta.

First, by helping Athens, the whole kingdom will see you as generous and kind men, which will increase your popularity and give you more power. In addition, I believe that with the help, we will be able to have commercial advantages, imposing some conditions on Athens, which will help us in relation to our economy, which will enrich and strengthen Sparta. Finally, I believe that aid to Athens will provide us with an ally, who will be very useful in knowledge and technologies.

However, we cannot fail to be careful with the sharp thinking of the Athenians, as they can turn against us after they use our help. Athenians are great thinkers and can use us to control us. This we cannot allow and we must control it first, through our kind help.

Whenever a Georgia court interprets a law, it must, above all, make sure the law
(A) is popular among registered voters.
(B) is consistent with the state constitution.
(C) has been written in easily understandable English.
(D) has been approved by big corporations or unions.

Answers

B is the answer!!!!!!!!!

Answer:

It is B.

Explanation:

Other Questions
Describe how the Spanish-American War was started? In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!! what signals the end of the cell cycle i. Solar cells are marketed (advertised) based upon their maximum open-circuit voltages and maximum short-circuit currents at Standard Test Conditions (STC). A. What is the definition of STC for a solar panel?B. From what you measured how would you "advertise" the capability of this solar cell? C. Why are your maximum measured values not necessarily representative of the how a solar cell is actually used? ii. If the same light source were moved farther away, how would this affect the current and voltage measured at the output of the solar panel? Explain why. ii. If the same light source is used, but the solar panel temperature is much hotter, how would this affect the current and voltage measured at the output of the solar panel? Explain why. iv. If you were given access to multiple solar panels of the same model, design a circuit to achieve: A. 3 times more current B. 3 times more voltage A function is defined by f(x) = x+2, 0. A region R is enclosed by y = f(x), the y-axis line y = 4.Find the exact volume generated when the region R is rotated through 27 radians about the y-axis. Hi 123-123+123+123=????