All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?
Answer:B
Explanation:
How is the Grand Canyon related to volcanic activity?
In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River. ... 1064 a series of eruptions built the park's namesake cinder cone.
hope this helps ^^
Answer:
In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River.
Explanation:
Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation
What is the energy source that allows photosynthesis to occur?
Answer:
[tex]\boxed {\boxed {\sf The \ sun }}[/tex]
Explanation:
Photosynthesis is a special process that certain organisms (plants, algae, and some bacteria) undergo to create "food".
This turns light energy, carbon dioxide, and water into glucose and oxygen. The glucose becomes the food for the organism, because it is turned into ATP during cellular respiration. The ATP is energy that fuels the processes, like growth, repair, and transport.
This process occurs because of the sun. It provides the light energy needed for the reaction. Organelles inside of the cells, called chloroplasts, contain a pigment (chlorophyll) that captures this energy.
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
Describe the process of water moving in and out of the cell.
Answer:
Water moves across cell membranes by diffusion, in a process known as osmosis. Osmosis refers specifically to the movement of water across a semipermeable membrane, with the solvent (water, for example) moving from an area of low solute (dissolved material) concentration to an area of high solute concentration.
Explanation:
Color blindness is a X-linked recessive trait. A couple want to predict whether it would be possible for their child to be color blind. The female is an unaffected carrier and the male is red/green color blind. What percentage of offspring would be color blind?
Answer: There is a probability (n.b. NOT certainty) that half of all offspring will be colour blind.
Explanation: The female is XX and as an unaffected carrier we can assign genotype Cc where c is the recessive allele.
The male is XY and colour blind, so genotype cY
Male offspring can be cY or CY so p|colourblind = 50%
Female offspring can be Cc or cc so, again p= 50%
If there is also equal probability of sex of the offspring, there is an overall probability that half the offspring will be colour blind
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
X could be an Arecaceae
Both roses and ferns are used as ornamental plants
Explanation:
Hope I got this right!! I really love plants! aslo feel free to report this answer if I was wrong!
What agent of erosion is this? Gravity,wind, waves, running water or glaciers.
Answer:
wind
Explanation:
Where do the mineral resources in which society depends on come from
Answer:Without minerals we would not have electricity, food, or shelter. Minerals make today's technology-based life possible, but that's something many of us take for granted.
Explanation:Soil, rocks, and minerals provide essential metals and other materials for agriculture, manufacturing, and building. 7.7. Earth scientists and engineers develop new technologies to extract resources while reducing the pollution, waste, and ecosystem degradation caused by extraction.
DNA analysis has little to offer from forensic science
true or flase
Answer:
DNA analysis has little to offer forensic science is false.
Explanation:
DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis
During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a △G of -20 kcal/mol. If you double the amount of enzyme in the reaction, what will be the △G for the new reaction?
A. +20 kcal/mol
B. -40 kcal/mol
C. -20 kcal/mol
D. -10 kcal/mol
Answer:
Option-C
Explanation:
Delta G (△G) refers to the overall energy released during a chemical reaction when equilibrium is reached i.e the rate of conversion of product into the substrate is equal to the rate of conversion of substrate into product. Thus, △G accounts for the equilibrium of the reaction.
In the given question, it has been mentioned that △G of a reaction is -20 kcal/mol then how will it change if the amount of enzyme is doubled.
The △G is not affected by the enzyme concentration as the presence of enzyme affects the G (Gibbs free energy) and activation energy.
Therefore, △G will remain the same even if the amount of enzyme is doubled i.e -20 kcal/mol will be the correct value.
Thus, Option-C is the correct answer.
Which person is collecting data through the participant observation method?
O A. William, who is reviewing the comments people wrote on
questionnaires
B. Dakota, who is calculating the results from a survey
OC. Hosea, who is watching people in their normal suroundings
OD. Brittany, who is reading research done by others
Answer:
C. Hosea, who is watching people in their normal surroundings.
Explanation:
The simplest structures that can carry out all of the activities characteristic of life are:
A. cells.
B. atoms.
C. molecules.
D. crystals.
What is antibiotic resistance and why should we be
worried?
Answer: Antibiotic resistance is when bacteria develops a resistance or an immunity against antibiotics. If this evolution/adaptation becomes widespread, our healthcare system could see a mass rise in deaths due to us not being be able to effectively treat the bacteria which is causing harm.
Explanation:
I learned about this
PLEASE ASAP NEED HELP PLEASEEE !!!!
Answer:
Hunting in groups, keen eyesight, chemicals to paralyze prey
Explanation:
Answer:
Hunting in groups
Keen Eyesight
and Camouflage
Explanation:
These are all the main adaptations that predators are born with. The rest of them do not help them at all. PLease give brainliest :)
how do vital signs allow medical professionals to assess a patient's physiology and overall health
they measure the pulse rate and blood pressure of a patient, these can help to determine if a patient has any diseases of the blood or if they are under stress.
Which choice correctly summarizes meiosis into one statement?
Answer: D
Explanation:
Why might Ponyboy have idolized Pual Newman?
What type of cell is more likely to replicate and replicate faster brain cell or hair cell
Answer:
hair cells is most likely to replicate faster than the brain cell
Explanation:
__________
If the food on the island is small seeds, what finch is best adapted? Explain why
Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.
Explanation:
which level of the food chain is most affected by biomagnification
Answer:
animals near the top of the food chain are most affected because of a process called biomagnification. Many of the most dangerous toxins settle to the seafloor and then are taken in by organisms that live or feed on bottom sediments.
Explanation:
Have a great one!
Is nature or nurture more important
Answer:
Yes
Explanation:
cus
it keeps us alive
Can someone help me thank you!!
Answer:
CARBON
Explanation:
The cell part that helps with cell division is the ________
Answer:
centrioles
Explanation:
Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
What process in humans is a good representation of asexual reproduction?
A. Meiosis
B. Mitosis
C.Fertilization
Answer:
B.
Explanation:
The _______________ rate describes the rate at which the atmosphere gets colder as the air gets thinner at higher altitudes.
Answer:
Lapse rate
Explanation:
Which antivenom will save Tyler?
Select one:
a.
Antivenom A
b.
Antivenom B
c.
Antivenom C
d.
Antivenom D
Answer:
A
Explanation:
It is A
1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.
Answer/Explanation:
During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.
But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.