HELP! I'll give the brainliest!!

HELP! I'll Give The Brainliest!!

Answers

Answer 1
agianst a concentration gradient so the second one
Answer 2

Answer:

In facilitated diffusion, molecules move down their concentration gradient.

Explanation:

In facilitated diffusion, substances move into or out of cells down their concentration gradient through protein channels in the cell membrane. Simple diffusion and facilitated diffusion are similar in that both involve movement down the concentration gradient.

Osmosis refers specifically to the movement of water across a semipermeable membrane, with the solvent (water, for example) moving from an area of low solute (dissolved material) concentration to an area of high solute concentration.

Active transport is the movement of dissolved molecules into or out of a cell through the cell membrane, from a region of lower concentration to a region of higher concentration. The particles move against the concentration gradient , using energy released during respiration .


Related Questions

Which list the layers of the atmosphere from earth surface outward?

Answers

Answer:

In order from earth to space it would be troposphere, stratosphere, Mesosphere, Thermosphere, exosphere (ionosphere.)

Explanation:

^

troposphere, stratosphere, mesosphere, thermosphere

1. Describe the shape of a DNA molecule.​

Answers

Answer:

Explanation:

If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

Answer:If you think of the double helix structure as a ladder, the phosphate and sugar molecules would be the sides, while the bases would be the rungs.

what animals eat leafy sea dragons? also want to do leafy sea dragons eat?

Answers

Answer:

(1) In the wild, young sea dragons are preyed upon by other fish, crustaceans and even sea anemones.

(2) Leafy seadragons eat small, plankton crustaceans.

____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)

Answers

Answer:

lenses can be used for diffrent types of surgery

pls help!!

Which row shows the chambers of the heart, from those with the thickest walls to those with the
thinnest walls?
from top to bottom it goes from the thickest to thinnest
A.
atria
left ventricle
right ventricle
B
atria
right ventricle
left ventricle
с
left ventricle
right ventricle
atria
D
right ventricle
left ventricle
atria

Answers

The answer is: B Atria, Right Ventricle, Left Ventricle
The right and left atria because they are low-pressure chambers that serve as storage units and conduits for blood so they would be the thinnest

what type of EM waves are used to observe objects from outer space

Answers

Answer:

Space telescopes can carry instruments to observe objects emitting various types of electromagnetic radiation such as visible, infrared or ultraviolet light; gamma rays; or x-rays. X-ray telescopes, such as the Chandra X-ray Observatory, use X-ray optics to observe remote objects in the X-ray spectrum.

Explanation:

becuse u ugly jk jk jk im not serious ok

Type of EM waves used to observe objects from outer space would be infrared, ultraviolet light, gamma rays, and x-rays

2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon

Answers

Answer:

B

because iron appears the color red

What are the DNA strands called?
What is the RNA stand called?

Answers

Answer:

it rna means

Ribonucleic acid

Answer:

DNA strands - polynucleotides

RNA strand - nucleotide chain

Explanation:

DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.

RNA is composed of a single nucleotide chain.

Hope this helps :)

1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?

A. It is added back to the soil by decomposers.


B. It is used by the producer to pass on to the next trophic level.

C. It is used for cell processes or released as heat.

D. It is consumed and used by the consumer.

2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.

B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.

C. Secondary and tertiary consumers are larger, so there are fewer of them.

D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.

3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.

Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _

A. 135 Kcal

B. 1,350 Kcal

C. 135,000 Kcal

D. 13,500 Kcal

4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?

A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.

B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.

C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.

D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.

5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100

A. 15%

B. 20%

C. 10%

D. 12%

Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3​

Answers

Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D

~Ten Percent Rule Quick Check~

1. B) It is used for cell processes...

2. D) Secondary and tertiary consumers have to consume a lot more..

3. D) 135 Kcal

4. C) Kudzu, a plant from Japan...

5. A) 15%

^This is confirmed valid as of January 17th, 2022^

Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.

The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

The trophic levels can be explained as:

1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.

2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.

3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.

4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.

5. Given,

Energy of Seal = 2,500 Kcal

The energy of polar bear = 375 Kcal

The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.

Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

Learn more about energy transfer and trophic level here:

https://brainly.com/question/20586850

Bromine is a liquid at room temperature. The volume of a sample of bromine is measured in a 50 ml beaker and a 100 ml beaker. How will the two
measurements compare?
A. The volume of bromine will be larger in the 100ml beaker.
B. The volume of bromine will be smaller in the 50ml beaker,
C. The volumes will be the same.
D. Both A and B

Answers

I think it’s D bye have a nice day

The actual volume of bromine in each beaker will be same only the difference in height will be comparable. Therefore, option (C) is correct.

What are the properties of liquid ?

A liquid's attributes are;

1) Compared to the volume occupied by a gas, the volume of a liquid is relatively stable at conditions that allow it to remain in the liquid state.

2) A liquid will take the form of the container it is placed in.

3) A liquid's surface in a container must be flat for the attraction forces between its molecules to be in equilibrium both at the liquid's surface and within its body.

Therefore, there will be variations in the measured height of the same volume of bromine in each beaker given that the volume of the bromine is measured in a 50 ml beaker and a 100 ml beaker.

Learn more about Liquids, here:

https://brainly.com/question/13279941

#SPJ5

Help (will give crown for answer)

Answers

Answer:genes

Explanation:

What are some treatments for cancer? Select all choices that apply.
A. removal by surgery
B. treatment with high-energy radiation
C. treatment with chemical compounds
D. removal by cyclins

Answers

Answer:

I know its A and B but I'm not sure if there are other treatments besides those two

Explanation:

Removal by surger and  treatment with high-energy radiation.

What is treatment of cancer?

Cancer is a condition when a few of the body's cells grow out of control and spread to other bodily regions.

In the millions of cells that make up the human body, cancer can develop practically anywhere. Human cells often divide (via a process known as cell growth and multiplication) to create new cells as the body requires them.

Occasionally, this systematic process fails, causing damaged or aberrant cells to proliferate when they shouldn't. Tumors, which are tissue masses, can develop from these cells. Tumors may or may not be cancerous.

Therefore, Removal by surger and  treatment with high-energy radiation.

To learn more about cancer, refer to the link:

https://brainly.com/question/8590464

#SPJ2

Plz help I’ll mark brainliest

Answers

Answer:

I'm pretty sure it's exponential growth.

Explanation:

Answer:

expontential growth!!

Explanation:

Priscilla was building a circuit that used copper wires to connect a battery to a light bulb. As she connected the final wire from the light bulb back to the battery, the light bulb turned on. Priscilla knew that current was now flowing through her closed circuit. What makes the current in the circuit flow?

Answers

Answer:

The complete path provided by the closed circuit enables electric current produced by the battery to flow round the circuit

Explanation:

Electric current consists of charges (electrons) in motion from one region to another.

An electrical circuit is any closed path through which electric current can flow.

An electrical circuit consists of an energy source that supplies the electrons moving, a path along which the electrons can travel, and a load or appliance that uses the electrical energy. When the circuit is broken at any point, electrons will cease to flow since there is no complete path for it to flow. Such a circuit is known as an open circuit.

In the circuit built by Priscilla, the battery serves as a source of energy by providing the electrons that moves round the circuit. The wires provides the path for electrons to flow from the battery through the light bulb and back to the battery. When she connected the final wire from the bulb back to the battery, the circuit becomes complete/closed and current then flows to light up the bulb.

William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can he consider for his report?

Answers

Answer:

Forest ecosystem or marine ecosystem.

Explanation:

Forest ecosystem is considered for his report because large number of organisms are present in forest ecosystem. Species diversity is greatest in the geographical location of tropics, particularly in tropical forests. Marine ecosystem is also considered for his report due to the presence of large number of different types of species particularly in coral reef which is a habitat of large number of organism.

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

The sun, rocks, water are all example of...

Answers

Answer:

are examples of abiotic factors

Explanation:

I think it’s natural resources.

How is energy released from ATP?

Answers

Answer:

food zygote d9gugousfoysocysohcoecu sperm

Answer:

In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. ... When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.

Plants receive carbon dioxide through their ____________.

Answers

Answer:

leaves,stomata

Explanation:

The carbon dioxide enters the leaves of the plant through the stomata present on their surface.

Answer:

Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots.

Explanation:

What is the role of the nucleus in plant and animal cells?
O
A. It stores the genetic information for the cell.
B. It serves as a boundary for the cell.
o
C. It produces energy for the cell.
O
D. It stores waste for the cell.

Answers

Answer:

Explanation:

It’s A I’m pretty sure

Which of the following could result if meiosis did not occur in the process of sexual reproduction?

Answers

What would happen if meiosis did not occur in sexually reproducing organisms? The chromosome number would double in each generation because the process of meiosis halves the number of chromosomes in the gametes. ... the exchange of genetic material between homologous chromosomes that results in recombinant chromosomes.

Hope this helps a bit

Use the word “capacity”in a sentence.

Answers

Answer:

The weight capacity in this elevator is over its limit, somebody is gonna have to  step out

When a person's temperature gets too high, they will automatically sweat to cool down.
Sweating is considered a ___________________.

Answers

Answer:

Perspiration

Explanation:

If you had options that could have helped but I think perspiration is the correct answer.

Hope this helps :D

Make a food web for the rainforest

Answers

Answer:

VEGETERIANS, VEGANS, CARNIVORES, CANNIBALS, Omnivores

Explanation: EVERYWHERE!!

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

PLS HELP ME IM STRESSING RIGHT NOW I JUST NEED HELP ON THIS

Which statement accurately describes a mountain ecosystem?
They usually host three or more ecosystems where animals can’t live.
They usually host one ecosystem with a variety of wildlife.
They usually host one ecosystem with a variety of plants.
They host three or more distinct ecosystems.

Answers

Mountain life has many life and plants, so it’s not A, it could be b or c but D makes most sense I don’t know what 3 or more distinct ecosystems mean though

A environmental scientist buys 20 gallons of oil eating bacteria to help remediate an area affected by an oil spill. The volume of water the scientist wants to cover with this bacteria is 5 ft³. What volume of water can the scientist cover with the bacteria she purchased? (1 gal = 0.13 ft³)

Answers

Answer:

2.6  [tex]ft^3[/tex]

Explanation:

Using the conversion factor:

1 gallon = 0.13 [tex]ft^3[/tex]

Therefore,

20 gallons = 20 x 0.13

       = 2.6‬  [tex]ft^3[/tex]

This means that only 2.6  [tex]ft^3[/tex] out of the 5  [tex]ft^3[/tex] total volume of water the scientist wants to cover can actually be covered by the bacteria that was purchased.  

How do I fly? :(;):)

Answers

Answer:

Hm

Explanation:

Try a few things like an airplane, jetpack, etc

By flying and flying and Flying some more

Which nutrient cycle has no Gas Phase?

Answers

Answer:

Describe the steps that you would take to effectively prepare for a discussion about a debatable issue.

Explanation:

How might it be possible for your baby to show a trait that neither you or your mate has?

Answers

Answer:

it could be passed on from generations, even though if your mother or father doesn't have those traits

Other Questions
BRAINLIEST! URGENT! Please help me with this problem, also if you dont know the answer and just typed in some random stuff, it will be reported...dont steal points. BRAINLIEST PLEASEEE HELPLP 5. In a lab experiment, 2.5 grams of sodium bicarbonate is heated and decomposed intosodium carbonate, carbon dioxide, and water vapor when heated. The actual yield ofsodium carbonate produced in the experiment is 2.04 grams. The theoretical yield ofeach product is recorded in the data table below.Using this data, determine the percent yield for sodium carbonate?(Round Your Answer to the Nearest Whole Number) 20. When subtracting u- v, I must rewrite the pair asa. ut -Vb. -U + VC. u + vd. It doesn't matter; I will get the same vector PLZZZZZ HELP. Short Answer with Hints Directions: Use the hints to help you fill in the table.What are the eight features of civilization?1.Hint: Ur, Lagash, Babylon2.Hint: Democracy, Monarchy, Totalitarianism3.Hint: Christianity, Islam, Judaism4.Hint: Farmers, Blacksmiths, Priests5.Hint: King, Merchants, Slaves6.Hint: Thai, Spanish, Portuguese7.Hint: The Mona Lisa and the Empire State Building8.Hint: The Towers of BabylonNow take one of those features and explain why it is important to a civilization. what is the counterclaim in an argument 3.and my heart feel as oneWith the earth,the sky,and the sunPlz help:(Which one rhyme 52 5 + (42 2) 36 9 Solve the following expression 8 + (-20) The Great Plains Region offered what type of economic activities? A.fishing B.farm cropsc.medicalD.finance True or False: You can tell by looking at someone if they have a mental illness.I need help with this ASAP. 1. American farmers in the West sent their goods down the__ , where they were sent by ship Mississippi River to to markets on the east coast.2. A revolt in which Caribbean nation helped to make the Louisiana Purchase possible?3. Why was Thomas Jefferson initially concerned about accepting the terms of the Louisiana Purchase?4. Why was Thomas Jefferson personally interested in the exploration of the new Louisiana Purchase? Why was Congress interested?5. Why did the addition of the Louisiana Purchase to the United States cause New England Federalists to consider forming a "Northern Confederacy"?just a sentence for each is fine, Thank you :) Use the crisscross method to find the chemical formula for the ioniccompound formed by aluminum (Al) and sulfur (S).Help what are predicate nominatives During energy conversions, some energy is always lost asheatelectricitychemical energyLight A pizza shop sells three sizes of pizza, and they track how often each size gets ordered along with how much they profit from each size. Let X represent the shop's profit on a randomly selected pizza. Here's the probability distribution of X along with summary statistics: Small Medium Large X = profit ($) 4 8 12P(X) 0.18 0.50 0.32Mean: X = $8.56 Standard deviation: x =$2.77 The company is going to run a promotion where customers get $2 off any size pizza. Assume that the promotion will not change the probability that corresponds to each size. Let Y represent their profit on a randomly selected pizza with this promotion. What are the mean and standard deviation of Y? There are 2 glasses of orange juice , glass a has squash mixed together with water in the ratio 1:3 and glass b had squash mixed together in the ratio of 1:5 I mix together an equal amount of juice from glass a and b . What will be the new ratio of squash to water a)In the first event, the eighth graders are running a baton relay race with three other classmates. The teams top speed for each leg is 56.81 seconds, 59.22 seconds, 57.39 seconds, and 60.11 seconds. Use the information to predict the teams best time for the race A dolphin travels through the water at a speed of 25 kilometers per hour. Which representation shows the distance a dolphin can travel at this rate Plz help me !!!!!!!!!!!!! The temperature was -12 degreesCelsius and rose to 2 degrees Celsius.What was the change in temperature?Hurry