help translate to english then answer the questions



2. in the three-level altar what objects do they put on the underworld level

3. What objects do thsy put on the level of earth

4.What objects do they put on the level of heaven

5. why do they also put candles and sugar skulls in all the levels. ​

Help Translate To English Then Answer The Questions2. In The Three-level Altar What Objects Do They Put

Answers

Answer 1

Answer:

2. flores de color violeta, incienso de copal, agua y una cruz

3. foto de un muerto, objetos personales, las comidas y bebidas favoritas del muerto, flores de cempasúchitl y pan de muerto.

4. ponen velas y calaveras de azúcar en todos los niveles porque las velas ayudan a los muertos a encontrar sus casas y las calaveras representan la muerte y confirman que la muerte esta presente en todas partes

Answer 2

Answer:

2:Flores de color violeta, incienso de copal, agua y una cruz.

3:Foto del difunto, objetos personales, comida y bebida favoritas de el difunto, flores de cempaxúchitl y pan de muerto

4:Papel picado y flores blancas.

5:Las velas son para ayudar a los difuntos a encontrar el altar, y  las calaveras de dulce son para confirmar que la muerte se encuentra en todos lados

Explanation:


Related Questions

Please help meeeeeee

Answers

1 me
2 you
3 them
4 they
5 them
6 us

Answer:

yo= bebo

tu= bebe

el/ella= bebo

usted=bebo

nosotros= bebemos

ellas/ellos= bebo

ustedes=beben

How would you say “I prefer ice cream” in Spanish?
O Yo prefiero el helado.
OTú prefieres los batidos.
O Yo hago el preparado.
OTú prefieres los pasteles.

Answers

Answer:

Yo prefiero el helado.

Explanation:

Answer:

The correct answer is A

Explanation:

A:  Yo prefiero el helado

what is the error and correction for : Ellas Bailáis bien

Answers

Answer:

Ellas bailaron bien

Explanation:

Help!! Conjugate! (Gustar and other verbs)

Answers

Answer:

interesabaparecequedanencantavuelvenalegragustaraninteresegustaroncaen.

Answer:

interesaba, parece, quedan, encanta, vuelve, alegra, gustara, interese, Gustaron, caen

Explanation:

Cuando era joven, me interesaba mas ver películas de acción que películas de romance,  

A René le parece una mala idea dejar que los niños vean tanta violencia en la televisión,

¿Cuántos minutos te quedan para terminar el documental?

Al teleadicto le encanta ver la televisión mas que hacer otras cosas con su tiempo libre

A Rebeca le vuelve loca las telenovelas por la actuación tan dramática

Ana se alegra de que vayan a ver la comedia en vez de la película del oeste

Martin esperaba que a sus amigos les gustara las películas que rento  

Es posible que no te  interese ver este programa en la televisión

Nos  gustaron las telenovelas que vimos ayer

¿Te caen bien las personas que solo quieren ver películas de romance?

Elige. Select the word or phrase that best completes each statement.

1. Los amigos tristes.


estás -- está -- están -- estamos

2. La chica rubia.


soy -- es -- somos -- son

3. Mi profesora Mrs. Johnson.


me llamo -- se llama -- os llamáis -- se llaman

4. Un amigo de mi hermano muy guapo.


es -- soy -- eres -- son

5. Las niñas fans del fútbol.


eres -- sois -- soy -- son

Answers

Answer:

1. están

2. es

3.  se llama

4. es

5. son

Hope that helped! :)

Explanation:

¿De _____ color es el perro?
1. sustantivo
2. qué
3. quién
4. grande

Answers

Answer:

yes indeed

Explanation:

2: que

if you were to choose 1, the sentence would say, “what noun is the dog?”

if you chose 3, the sentence would say “what who is the dog?”

therefore the answer is 2.

emergency please help me .
Write a blog post, in Spanish, that describes what to do in different emergencies. Write about 5 sentences and use the subjunctive in your answer.​

Answers

Answer:

1)  ve a un lugar seguro, si puedes

2) mantente calmado

3) tienes que llamar al 911

4) Obtenga tanta información sobre la emergencia como sea posible, sin ponerse en peligro. Transmita la información a los servicios de emergencia cuando lleguen al lugar.

5) espera por ayuda, si no corres peligro

hiiiiiiiii

plz marked as brainlisttttt

Answer:

Si tienes un accidente, es necesario que tengas una lista de números telefónicos de emergencia. En caso de una lesión, es necesario que llames al servicio de ambulancia. Si eres víctima de un robo, es importante que hagas una denuncia policial. Es aconsejable que no vayas cerca de un fuego y llames a los bomberos.

Explanation: Plato/ Edmentum Users

Which of the following would most likely be included in un batido?
O el bistec
O la cebolla
el pescado
Olas uvas

Answers

Answer:

O   Las uvas

Explanation:

Which of the following would most likely be included in un batido?

O  las uvas  (grapes)

Answer:

uvas

Explanation:

jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

Look at the sentence that follows. When translated to Spanish, would it use the subjunctive?

I hope that mom makes a good dinner.
•No.
•Yes.

Answers

When translated to Spanish, yes, it would use the subjunctive because there is the expression of doubt.

What is Subjunction?

This refers to the use of words that shows the emotions of a speaker through the use of verbs or the speaker's attitude.

Hence, we can see that from the given sentence, there is the statement about the hope and wish which is a form of doubt that mom would make a good dinner, so it would be subjunctive.

Read more about subjunction here:

https://brainly.com/question/16794434

#SPJ2

Answer:

yes

Explanation:

Please help me. Based on the questions and answers provided in the first column of the table below, fill in the empty box in the second column with the correct Spanish pronoun.

Answers

1. usted
2. ustedes
3. ella
I love Spanish and have a great day

Juan _____ cómo hacer la tarea. sabe conoce 2. No, no _____ a tu hermano. sé conozco 3. ¿_____ dónde está la biblioteca? Sabes Conoces 4. ¿_____ Madrid? Conoces Sabes 5. Elena y yo no _____ mucho sobre la química. Conocemos Sabemos

Answers

1- Juan sabe cómo hacer la tarea.
2- No,no conozco a tu hermano.
3- ¿Sabes donde está la bicicleta?
4- ¿ Conoces Madrid?
5- Elena y yo no conocemos mucho sobre química.

Can someone help me out? I have no idea what it wants me to do.​

Answers

Answer:

It wants you to fill out the blank spots or lines.

>_< ( brain stopped working for a second)

So in other words it wants you too fill it out like if you are talking to someone or what makes sense in the sentence. Example (*note this is not in the page i don't think*) Voy a comer ___ helado.   the underline will be filled in with options of words that in that paragraph will have.

The words on the right are options that will make sense in the sentence . Make sure you read them with the sentence and it make sense and the spelling is correct too.

GOOD LUCK !! :D I am here for you . (Hope that help you)

*this sentence or story you could say is about school. In other words it says in some sentences this is my friend and we go to school together, and yeah so subject is school*

Write the words from the right into the spaces on the left with the corresponding number. Before you do that, you need to conjugate or modify it if necessary. For example:

#1: Ser

You would write soy in the space instead of ser, because the correct conjugation of ser in this sentence would be soy. “Yo soy Andrea Chàvez...”

#3: bueno

You would write buenos in the space instead of bueno because you are modifying the word amigos which is plural. “Somos amigos buenos.”

Para analizar un texto es posible dividir la lectura en dos partes ¿Cuáles son estas? a) lectura panorámica y lectura rápida b) lectura rápida y profunda c) lectura profunda y eficiente d) ninguna de las anteriores

Answers

Answer:

La respuesta es c)

Explanation:

lima, the capital city of peru is a modern city (true or false)

Answers

Answer:

it's true, lima is the capital city of peru

Answer:

True

Explanation:

Edge 2021, have a good day :-)

¡En español
Look at the video still and answer these questions in Spanish. Carlos is in
Mexico City, can you guess what place? Who is Carlos talking to? What do
you think this person does?

Answers

Magico city like the Mexicano

violencia doméstica al hombre y mujer

Answers

Answer:

¿Por qué dirías eso? no es una pregunta

Explanation:

Answer:

.

Explanation:

Yo corre mucho.

-Correct
-Incorrect
And why

Answers

Answer:

Incorrect.

Explanation:

If you wanted to say "I run a lot," which is what this sentence wants to say, you would conjugate "correr," to run, to match the pronoun. The correct "yo" form would be "Yo corro mucho."

No that is incorrect!!!!!!!!!!

Que es el Preterito y el Imperfecto? Y pongan ejemplos porfavor gracias​

Answers

El pretérito:

El pretérito sirve para presentar acciones como terminadas o cumplidas. Las presentamos como “históricas”. Se presentan como si no tuvieran ninguna conexión con el presente.

Ayer fue un día horrible. No pude bañarme porque no hubo agua caliente. Por un minuto pensé ir al gimnasio para hacer ejercicios y tomar una ducha pero no encontré mi carné de identidad. …

El imperfecto no tiene este rasgo semántico. Solo expresa que un evento era en el pasado. No contiene ningún límite. Pretendemos que no sabemos ni cuando empezó ni cuando terminó.
Aunque lógicamente sabemos que lo que se cuenta ya está pasado, emocionalmente nos situamos en medio de alguna acción inacabada que todavía no se había acabado cuando hablábamos de ella.

El lunes era un día horrible. Después de levantarme quería bañarme pero no había agua caliente. Pensaba ir al gimnasio para hacer ejercicios y tomar una ducha después pero no encontraba mi carné de identidad. …

A. Fill in the blanks below with the masculine and feminine, singular and plural forms of the possessive adjectives indicated. Some answers have been provided for you.

Answers

Answer:

Mi hijo

Tu hijo

nuestro hijo

Mi hijo tu hijo nuestro hijo Im fluent in Spanish hope this helps you

What is the error and correction for : nosotros montan en bicicleta.

Answers

Answer:

The mistake is bicycle and the correct way should be "bicycles."

"andamos en bicicleta"

Explanation:

Answer:

Nosotros montan (error)

Ustedes, ellos, ellas   montan   (correct)

Nosotros, nosotras   montamos    (correct)

¿Cuáles son algunas características de la poesía de Jorge Debravo?

Answers

Como una flor cresio para ser mad maravillosa

You are writing an e-mail to a friend about the cafeteria food in your school. Choose the most logical verb from the choices.

4) Los profesores no __________ en la cafetería con los estudiantes.



Question 5 options:

como


comes


come


comen

Answers

Answer: comen

Explanation:

the correct answer is comen

what is the answer to this question guys

Answers

Answer:

Soy

Explanation:

"Soy" is the "yo" form of "ser". You're saying "I am".

It’s soy , Yo no soy de Puerto Rico

María and Cristina are talking about the foods that they like. Complete their sentences by writing the correct form of the verb gustar or encantar given in parentheses.


3) A ti te __________ la ensalada de frutas, ¿no? (encantar)



Question 8 options:

encanta


encantan

Answers

Answer:

Encanta

Explanation:

3) A ti te ____encanta______ la ensalada de frutas, ¿no? (encantar)

The answer is Encanta
Bc if you say encantan you are talking about multiple people

La mujer es ____ que los ninos

Mejor
Mayor
Peor
Menor

Answers

Answer:

la mujer es mayor que los niños

b.mayor

We _________ together in the school library.

Answers

Answer:

Read

Explanation:

Well there can be different answers to this.
1. Read
2. Study

Those are two possible answers.

Maria y yo ______
tres carros.

tiene
tienen
tenemos
tengo

Answers

Answer:

Tenemos

Explanation:

Maria y yo ___tenemos___  tres carros.

Mara y yo TENEMOS tres carros.

Tiene would be used for another person. EX: Ella (She) tiene (has) tres carros (three cars).
Tienen would be used for other people that
doesn’t include you. EX: Ellos (They) tiene (have) tres carros.
Tengo means that only you would have it. EX: Tengo (I have) tres carros.

What is the hair color of Jorge's sister this week?

negro
azul
rojo
verde

Answers

After listening to the audio, we can choose option B, "azul," as the answer for the hair color Jorge's sister now has, as further explained below.

Colors in Spanish

For this question, we must have a knowledge of vocabulary in Spanish, more specifically related to colors. The ones we need to know are:

Negro - blackAzul - blueRojo - redVerde - green

Now, we were able to find the audio online but, unfortunately, it cannot be attached here. In the audio, it is possible to hear Jorge say "ahora es azul" when speaking of his sister's hair color. Therefore, "azul" is the correct option, as his sister now has blue hair.

Learn more about Spanish here:

https://brainly.com/question/18552923

#SPJ1

¿En que escuela estudio Stephen Hawking?

Answers

Trinity hall Cambridge y University of Oxford

Empareja cada frase con la descripción apropiada de las palabras en negrita. Pair each sentence with the appropriate description that matches the bolded words. (4 points)


1.
Él es un amigo viejo.


2.
Él es un viejo amigo.


3.
Es el único libro.


4.
Es un libro único.
a.
Él es abuelo y tiene 97 años. Él es muy amable.
b.
Yo he conocido a Pablo toda mi vida.
c.
La biblioteca solo tiene una copia del libro.
d.
El libro se trata de la vida de los perros de la punta de vista de los perros.
spanish speakers!!!!!!!!!!! plzzz help

Answers

Answer:

1.  Él es un amigo viejo.   ⇔    a.  Él es abuelo y tiene 97 años. Él es muy amable.

2.   Él es un viejo amigo.   ⇔   b.  Yo he conocido a Pablo toda mi vida.

3.   Es el único libro.    ⇔   c.   La biblioteca solo tiene una copia del libro.

4.

Es un libro único.    ⇔  d.  El libro se trata de la vida de los perros de la punta de vista de los perros.

Other Questions
what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns what is the range and domain of this question? im unsure A 45 kg object has a momentum of 225 kg-m/s northward. What is the object's velocity?A. 180 m/sB. 5.0 m/sC. 10,125 m/sD. 0.20 m/s Mrs. Chin paid a 20 percent tip on the bill for lunch.PercentsTotal20%20%20%20%20%100%$2.75$2.75$2.75$2.75$2.75If the tip amount was $2.75, what was the bill for lunch before the tip was added to it?$5.50$13.75$16.50$55.00 4n-(7-6n)Helppp plz Leia just read that the national debt owed by the federal government is at an all-time high. (Explain any possible impact on the federal government from unexpected inflation.) What is the mass of HF produced by three reaction of 3.0 10 to the 23 molecules of H2 with excess F2 Please help this one is also due tomorrow Lydia buys 5 pounds of apples and 3 pounds of bananas for a total of $8.50. Ari buys 3 pounds of apples and 2 pounds of bananas for a total of $5.25. Determine a system of equations that represents the given the situation. Let x be cost per pound of apples and let y be the cost per pound of bananas. Which equation represents the amount of money Lydia spent of apples and bananas? Which equation represents the amount of money Ari spent on apples and bananas? Choose the word or phrase that best completes each sentence. prepared the body for its journey to the afterlife.The were constructed as tombs for the pharaohs and their relatives.Tutankhamen's tomb was an important archaeological find because it was the only ever found. Ratios. May someone help me, also may you please add the explanation. question one : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) colliding with each otherquestion two : when two plates converge, they are what?a) moving away from each otherb) moving towards each otherc) sliding along each otherd) moving towards, then moving away from each otherquestion three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?a) the rocks are youngest the further away you move from the ridgeb) the rocks are oldest the further away you move from the ridgec) the rocks are the same age no matter how far away from the ridge you moved) the rocks do not age