helpppppp pleaseeee


question: Why do we need to know the mass of a robot? *
why is this in math why does my teacher does this

Answers

Answer 1

Answer:

To know what the answer is

Step-by-step explanation:

clearly I do not know, but I can say that we do need to know the mass bc in the future there will be more and more androids on the rising making human interaction bad.

to find out the equation take the seed and the time. (this to make it look like i answered) Taking the mass you will be able to find out how manyspeed is found by the time and masstime is found out by the mass and speedi dont know if this helped
Answer 2

Answer:

Step-by-step explanation:


Related Questions

Joe and Sally have $89.74 combined. They each had the same amount. What was that amount?

Answers

Answer:

179.48

Step-by-step explanation:

calculator

Answer:

44.87

Step-by-step explanation:

PLZ HELP ME AND I WILL MARK BRAINLIEST!!!

Answers

Answer:

-315 + 100 & -230 + 15

Step-by-step explanation:

1. 0 + -21.5 = -21.5 2. -20 + -1.5 = 21.5

Which point on the number line represents the product of 4 and –2?
Point A
Point B
Point C
Point D

Answers

Answer:

It's A

Step-by-step explanation:

the one above me is incorrect it's "A"

Answer:

A

Step-by-step explanation:

hi

A baseball weighs 25.75 ounces less than a bat. Write an equation the represents the relationship between the weight of a baseball and a bat in terms of the weight of the box,w.

Answers

Answer:

Step-by-step explanation:

So if a baseball weighs 25.75 ounces less than the bat and it says what is the relationship between the ball and the bat so if the baseball weighs less than the bat then that would be 25.75<B=W I believe

How to multiply Decimals by power of 10?

Answers

Answer:

maybe this well help

Step-by-step explanation:

When you multiply a decimal by a power of 10, simply move the decimal place to the right as many places as there are 0s in the power of 10. When you divide a decimal by a power of 10, simply move the decimal place to the left as many places as there are 0s in the power of 10.

Answer:

You can convert the power of 10 to a decimal and multiply it by 0.502, or you can move the decimal place of 0.502 to the left depending on the value of the exponent:

0.502 x 10^2=0.00502 → 10^2 is equal to 100. So, 0.502 x 100=0.00502 OR 10 is raised to a power of 2, so move the decimal place 2 times to get 0.00502.

0.502 x 10^3=0.000502 → 10^3 is equal to 1000. So, 0.502 x 1000=0.000502 OR 10 is raised to a power of 3, so move the decimal place 3 times to get 0.000502.

Hope you understand and that this helps with your question! :)

Explain why the rate of change of the radius of the sphere is not constant even though dV/dt is constant. dr dt depends on r2, not simply r. The volume only appears constant; it is actually a rational relationship. The rate of change of the radius is a linear relationship whose slope is dV dt . The rate of change of the radius is a cubic relationship. dr dt as a function runs parallel to the volume function, which is not linear.

Answers

Answer:

Hello your question has some missing parts below is the missing part

A spherical balloon is inflated with gas at a rate of 600 cubic centimeters per minute  

answer :

dr/dt  depends on r^2  not simply r

Step-by-step explanation:

The rate of change of the radius of the sphere is not constant even though dv/dt is constant is because ;

dr/dt  depends on r^2  not simply r

and this is because  dr/dt is proportional to  1/r^2 therefore the rate of change of the radius cannot be constant even though dv/dt is constant

If a turkey takes two hours and forty-five minutes to cook, and you place it in at 3:30, what time will it be ready.

Answers

Answer:

If a turkey takes two hours and forty-five minutes to cook, and you place it in at 3:30. It will be done at 6:15

Answer:

It will be ready at 6:15

Step-by-step explanation:

So you've got 2:45 for it to cook and it's been placed at 3:30. You can put it simply like:

2:45+3:30=x

x would represent the unknown time, all you need to do is add.

It's 5:75, but an hour only goes to 60 minutes and you've gone to 75.

You have to subtract 60 from the minute marker and add an hour:

5:75

 -60

6:15

Georgia wants to test a protein supplement
for muscle gain. It randomly selects 15
players to take the supplement and 15
players to take a placebo. Before and after
10 weeks of taking these pills, the players'
muscle mass is measured and compared.
This is an example of a(n):
A) Sample B) Observational Study
C) Census D). Experiment

Answers

Sorry I don’t know the answer hope you find one bye

please help me<3
i will give brainliest to the right answer

Answers

Answer:

26.5

Step-by-step explanation:

Because the sales is $530 and the commission rate is 5%, the commission would be 5% of the sales, which would be $26.5

Jenny had 56 candles. She sold 2/7 of them and then split it evenly among her and her sister. How many candles did each sister get?

Answers

Answer: Each sister got 8 candles

How?

(2/7)(56) = 16

16/2 = 8

Helpppppppppppppppppppppp ASAP

Answers

9514 1404 393

Answer:

  B.  G(x) = (x -0.5)³ -(x -0.5)

Step-by-step explanation:

The desired equation can be found by translating the function left one unit. That is accomplished by replacing x with x+1. Then you have ...

  G(x) = ((x +1) -1.5)³ -((x +1) -1.5)

  G(x) = (x -0.5)³ -(x -0.5) . . . . . . . . matches choice B

–5(–2) =
please help :) :D

Answers

Answer:

10

Step-by-step explanation:

-5 * -2 = 10

cuz - * - = +

and 5 * 2 = 10

hence 10

Answer:

-7

Step-by-step explanation:

-5(-2)

-5-2

-7

..........

please help



Your mom gives you $30 to buy some books. Write the money you have left as a function of the cost of books. Let
b represent the cost of books, and s represent the money you have left.

Answers

Answer:

D

Step-by-step explanation:

because b - 30 = s your buying something and subtacting from the money you had before

What is the greatest common factor of 49, 62 and 80? OA) 1 OE) 2 OC) 3 OD) 5​

Answers

Answer: A (1)

Step-by-step explanation:

The way to find a common factor is by dividing the given numbers by the largest possible multiple that still gives you a whole number

A

49/1=49

62/1=62

80/1=80

This is an option

B

49/2=24.5

62/2=31

80/2=40

This is not an option, 24.5 is not a whole number

C

40/3=16.333(repeating)

This is not an option, you are not given a whole number

D

49/4=12.25

This is also not an option, 12.25 is not a whole number

Answer

Our only possible answer is A-1

Find the probability of getting the color crewmate and the hat. Determine the probability for each question and write the code in the box below.

Answers

Answer:

Step-by-step explanation:

Probability of an event to occur (P) = [tex]\frac{\text{Favorable event}}{\text{Total outcomes}}[/tex]

1). Probability of getting the red crewmate,

   [tex]P_1=\frac{3}{6}=\frac{1}{2}[/tex]

   Probability of getting a chef hat,

   [tex]P_2[/tex] = [tex]\frac{1}{8}[/tex]

  Probability of getting the red crewmate and the chef hat = [tex]P_1\times P_2[/tex]

   = [tex]\frac{1}{2}\times \frac{1}{8}[/tex]

   = [tex]\frac{1}{16}[/tex]

2). Probability of getting blue crewmate,

     [tex]P_1=\frac{2}{6}[/tex]

          [tex]=\frac{1}{3}[/tex]

   Probability of getting an egg hat,

    [tex]P_2=\frac{2}{8}=\frac{1}{4}[/tex]

   Probability to get the blue crewmate and an egg hat = [tex]P_1\times P_2[/tex]

    = [tex]\frac{1}{3}\times \frac{1}{4}[/tex]

    = [tex]\frac{1}{12}[/tex]

3). Probability of getting a green crewmate = [tex]\frac{1}{6}[/tex]

    Probability of getting a banana hat = [tex]\frac{3}{8}[/tex]

    Probability of getting a green crewmate and banana hat

    = [tex]\frac{1}{6}\times \frac{3}{8}[/tex]

    = [tex]\frac{1}{16}[/tex]      

Find the first four terms of the arithmetic sequence
where a1 = 2 and d = 5 (use formula)

Answers

Answer:

first four terms are 2, 7, 12, 17

Step-by-step explanation:

use this formula:  [tex]a_{n}[/tex] = [tex]a_{1}[/tex] + (n - 1)· d

where 'n' equals the position in the sequence the term is in and 'd' is the common difference

if [tex]a_{1}[/tex] = 2 and d = 5 are given, plug those into formula

[tex]a_{1}[/tex] = 2

[tex]a_{2}[/tex] = 2 + (2 - 1)·5 = 2+5 = 7

[tex]a_{3}[/tex] = 2 + (3 - 1)·5 = 2+2(5) = 12

[tex]a_{4}[/tex] = 2+(4 - 1)·5 = 2+3(5) = 17

The first four terms of the arithmetic sequence are 2, 7, 12, and 17.

What is an arithmetic sequence?

It is a sequence where the difference between each consecutive term is the same.

We have,

First term = 2

Common difference = 5

First term = 2

Second term = 2 + 5 = 7

Third term = 7 + 5 = 12

Third term = 12 + 5 = 17

Thus,

The first four terms of the arithmetic sequence are 2, 7, 12, and 17.

Learn more about arithmetic sequence here:

https://brainly.com/question/10396151

#SPJ2

Select the correct answer.
The table shows the balance of an investment account at the beginning of each year the account was held. Assuming no other deposits have been
made to the account, which statement describes the account's growth?


Year 1- $1,200.00
Year 2- $1,260.00
Year 3- $1,323.00
Year 4- $1,389.15

A.
The account is growing exponentially at an annual interest rate of 10.25%.

B.
The account is growing linearly at an annual interest rate of 5.00%

C.
The account is growing exponentially at an annual interest rate of 5.00%.

D.
The account is growing linearly at an annual interest rate of 10.25%.

E.
The account is growing exponentially at an annual interest rate of 15.76%.

Does anyone happen to understand this? I don’t get it?

Answers

Answer: 2 aka B

Step-by-step explanation: the answers B :)

Find the numerical value of the expression if x = 4.
(6x-7)/(3x)

Answers

Answer:

1.416 repeating

Step-by-step explanation:

6 x 4 = 24, then do 24 - 7 = 17, then do 3 x 4 = 12, then divide 17 and 12 to get 1.416 repeating

Which step is incorrect and what is the correct answer?

Answers

Answer:

Step 4, x = 3

Step-by-step explanation:

Step 4 was wrong, instead of 6x = 6, it should be 6x = 18. They shoudl've added 6 to both sides instead of subtracting 6 as ur trying to cancel out the 6 on the left side of the equation. So:

6x = 18

x = 3

The population of fish in a pond in relation to the number of years since stocking is depicted on a graph. For the first few years after the pond is stocked, the population grows slowly. It increases more quickly as the fish reproduce, then it levels off. A pollutant kills off almost all of the fish 20 years after stocking. The population begins to grow again when the remaining fish reproduce. Which graph depicts the situation described above? ​

Answers

Answer:

Graph a

Step-by-step explanation:

the slope is proportional to the data

Graph A depicts the situation described above. Thus, option A is correct.  

What is a graph?

The link across lines as well as points is described by a graph, which is a mathematical description of a connection. A graph is made up of certain points and connecting lines. It doesn't matter how long the lines are or where the terminals are located.

The population of fish in a pond grows slowly for the first few years after it is stocked, then levels off. A pollutant kills off almost all of the fish 20 years after stocking, then the population begins to grow again when the remaining fish reproduce which is represented in graph A.

If every pair of datasets is connected in the same fashion, by multiplying by a factor, then the connection is proportional. The slope of a line is the slope of the regression. Like the ratio constant, this slope shows how rapidly a quantity is rising or falling.

Therefore, option A is the correct option.

Learn more about Graph, here:

https://brainly.com/question/17267403

#SPJ2

Answer the question below.

it's one of these

-16 / 3

-16 / 2

-8 / 8

-8 / 2

Answers

Answer:

-16 / 2

Step-by-step explanation:

You have 16 negative tiles and you are dividing it into 2.

Answer:

It is -16 / 2

Step-by-step explanation:

Please mark brainliest.

-4x+5y-3-11x-y

Does -3 have a like term?

Answers

Answer:

nope ❎ ❎ ❎ ❎ ❎ ❎ ❎ ❎

No it doesn’t, all of the other terms have a variable :)

Find the difference.

Need help fast!​

Answers

Answer:

D

Step-by-step explanation:

18 - 3 = 15

D is your answerrrrrrrr

Give the domain and range.

Answers

A should be correct


Hope it helps

Answer:

option a is correct answer

PLEASE I NEED HELP AND I ONLY HAVE AN HR Question 2 (4 points)
(04.02)

Determine whether the graph represents a proportional relationship. (4 points)

A graph is shown. The x-axis is labeled from 0 to 9. The y-axis is labeled from 0 to 15. Four points are shown on the graph on ordered pairs 0, 2 and 1, 6 and 2, 10 and 3, 12. These points are joined by a line. The label on the x-axis is Number of cars. The title on the y-axis is Number of wheels.

a
Yes, it is a proportional relationship because the graph goes through the origin

b
Yes, it is a proportional relationship because the graph is a straight line

c
No, it is not a proportional relationship because the graph is not a straight line

d
No, it is not a proportional relationship because the graph does not go through the origin

Answers

------> The Answer Is C <------

Hope this helps have a good day :D

A store has two different brands of laundry

Answers

Answer:

Step-by-step explanation:

I am sorry but please give detailed question

Answer:

Is there supposed to be a pic?

Step-by-step explanation:

Write an equation of the line that passes through the given point as is (a) parallel and (B) perpendicular to the given line

A. y=
B. y=

Answers

A: y=-4x+19
B: y=1/4x+2

what is the quotient of 3 divided 1/6

Answers

Answer:

To find the quotient of 3 divided by 1/6 you must multiply by the reciprocal of the fraction, in this case it is 6.

So you would rewrite it as,

3*6=18

So your answer is multiply 3 by 6.

P.S * represents multiplication.

Step-by-step explanation:

Max bought a new pair of basketball shoes that were on sale for 25% off. If the regular price of the shoes was $75.95, what is the amount of discount?

Answers

$56.96

1) 75.95 x .25= 18.9875= 18.99
2) 18.99 -75.95= 56.96

Find XY and YZ. X:-14, Y:-4.1, Z:17.3

Answers

Follow:

X:Y

Y:Z

-14 : -4.1

-4.1 : 17.3

so XY= ( 57.4)

YZ= (-70.93)

Other Questions
A certain first-row transition metal ion forms many different colored solutions. When four coordination compounds of this metal, each having the same coordination number, are dissolved in water, the colors of the solutions are red, yellow, green, and blue. Further experiments reveal that two of the complex ions are paramagnetic with four unpaired electrons and the other two are diamagnetic. What can be deduced from this information about the four coordination compounds Describe how chimpanzees use touch to communicate.No searching please. I already tried that and it wasnt the answer you need for the question. Give brainliest! 25 points! pls show work if can!!!!!!!! Why would more food lead to more jobs? Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo should the fact that a person has children in the UK over-rule their deportation after the have served a prison sentence ? What Solutions to population growthmight a penson from Europe suggest? What is 12x 9x 4x + 3 in factored form? hurry... Would you need circumference or area to find the amount of oil it takes to cover the bottom of a frying pan? At a book store there are 25 books on the clearance section. 20 of the books are young adult novels and the rest of the books are picture books. Which statement is not true?For every 4 young adult novels, there is 1 picture bookFor every 5 books, 4 are young adult novelsThe ratio of picture books to young adult novels is 1:4There is 1 picture book for every 5 booksAll statements are true As a result of the problems of the Industrial Age, some influential reforna new economic system.a single world government.a dictatorship in the United States. an end to all factories. pls help meh...... with the question.....pls it's urgent ........... A technician has a recipe for 32,500 mL; what is this in liters? -(4x - 7) + 1 = 2 (5 - 2x) solve for x You will start at the begining of the piece each time you practice. . True O B. False Right answer will get brainlist pleasee help choose the correct one Which best describes the scene that is described in Countee Cullens Tableau?A. Two children are running away from homeB. A man is remembering his grandfathers table C. A black boy and white boy are walking together as friends D.A black boy and a white body get into a fight on the street . example of secondary analysis Starch is a _____. jhcgrwzxcvhbnkjm