Answer: Complementary base- pairing creates a very stable structure
Explanation:
The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.
A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.
In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).
Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.
Read more: https://brainly.com/question/19755749
Which statement best describes the overall chang
O One cell becomes two cells that have identical
OOne cell becomes two cells that have different
O Two cells become tWo cells that have identical
O Two cells become two cells that have different
Answer:number one
Explanation:
Bam hi cuts between what bases
rences
ake a
Activity
Many farmers and gardeners compost their plant and animal waste. The living material naturally decays in
compost bins, forming a dirt-like substance that's rich in nutrients. The next season, farmers use this
substance as a natural fertilizer for their crops.
A biology student has grown tomato plants for several years. Until now, he used an artificial fertilizer
formulated for tomato plants. This fertilizer caused his plants to grow faster and taller than they grew in
unfertilized soil. The student wants to know whether using natural compost will cause his tomato plants to
grow faster and taller than his artificial fertilizer. Explain independent and dependent variables
Answer:
Please find the explanation of independent and dependent variables below using the experiment in this question.
Explanation:
Independent variable is the variable that the experimenter changes or manipulates in an experiment while the dependent variable is the variable being measured in the experiment.
According to this question, a biology student who has grown tomato plants for several years wants to know whether using natural compost will cause his tomato plants to grow faster and taller than his artificial fertilizer, which he used previously.
In this case, the "natural compost" is the independent variable while the dependent variable is how tall and fast the tomato plant will grow. Hence, the tallness or fastness is the dependent variable.
Evaluate the evolutionary benefits of regulating an internal variable, such as body temperature, versus the cost.
Answer:
The benefits of being able to regulate the internal body temperature are many and it is considered a beneficial evolutionary character, since in this way the living organism is better maintained in relation to the environment, and it achieves better balance.
Reptiles cannot control their internal temperature, it depends on the external one, that is why to warm their body they need to be in the sun, and to cool down in the shade or in temperate places.
This is a little evolutionary characteristic since the environment is very changeable and the right or ideal temperature for the organism could not be controlled.
Explanation:
Faced with climatic catastrophes or extreme situations, living organisms cannot depend on the great climatic variants, in very cold situations one enters hypothermia and in very hot conditions the proteins are systematically denatured, entering a thermal shock.
Fossil fuels, such as oil and natural gas, are primarily formed from the remains of what?
phytoplankton
mammals
bacteria
dinosaurs
Answer:
phytoplankton
Explanation:
Answer:
Its phytoplankten.
Explanation:
I hope I spelled it right
Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment. What relationship is shown here between the mistletoe and the tree?
A.Competition
B.Parasitism
C.Mutualism
D.Commensalism
Mistletoe extracts water and nutrients from the spruce, to the spruce tree's detriment. The relationship that is shown here between the mistletoe and the tree is Parasitism. Hence, the correct option is B.
What is Parasitism?Parasitism refers to a type of symbiotic relationship in which one organism benefits at the expense of the other organism, which is called host. The parasite lives on or inside the host and derive nutrients as well as shelter from the host, thereby providing no benefit to the host in return.
Examples of parasites includes tapeworms, roundworms, lice, fleas, and some species of bacteria and viruses.
Parasitism is a common for of symbiosis in nature and play an important role in shaping the relationships between species and maintaining balance in ecosystem. Hence, the correct option is B.
For more details regarding parasitism, visit:
https://brainly.com/question/29759870
#SPJ6
Please help me on this question
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation:
AUUUAACUGUUCUGUCUAGAG
1. Construct an Explanation Based only on the information provided, why could the
mRNA section be translated into three different sets of amino acids, instead of just one
set?
2. Use Models Use the genetic code to translate the sequence into each of the three
possible sets of amino acids.
3. Draw Conclusions Which of the three sets of amino acids is the most likely to be
included in the polypeptide? Explain your reasoning.
Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu
The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.
Explanation:
auu,uaa,cug,uuc,ugu,cua,gag
Ile,STOP,leu,phe,cys,leu,glu
glu,ile,cys,leu,val,asp,leu (reverse)
After a STOP codon, a DNA promoter is required
Codons are the trinucleotide sequence found in the DNA and RNA. These codons code for specific amino acids and describe the relationship between the nitrogenous bases of the DNA.
1. Codon is the set of three nucleotides, in which amino acids can be coded by different codons.
In the given sequence, the mRNA can translate the sequence into more than one set as the sequence must contain a promoter and a stop codon.
2. In the given set, the possible amino acid sequences can be given as:
Glutamic acid, isoleucine, cysteine, leucine, valine, aspartate, leucine
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
3. The codon sequence, which has a promotor sequence after a stop or start codon will have more chances to be translated during the process.
In the given sequence:
Isoleucine, Ochre, Leucine, Phenylalanine, Cysteine, Leucine, Glutamic acid
The polypeptide will be stopped due to the presence of a stop codon in the polypeptide.
To know more about codons, refer to the following link:
https://brainly.com/question/19153211
What are the products of photosynthesis?
Answer:
glucose and oxygen
Explanation:
just aced a unit test on this subject
The most common presenting sign/symptom with rheumatic fever is a. rash. b. painless nodules. c. polyarthritis. d. cardiac murmur.
Answer:
c. polyarthritis.
Explanation:
Rheumatic fever is an inflammatory disease that may affect different parts of the body including joints, heart, brain, and skin. It is a rare disease observed after a bacterial throat infection caused by Streptococcus (group A). The most common signs of this disease include swollen and/or tender joints (i.e., polyarthritis), especially in wrists, knees, elbows or ankles, fever, fatigue, pain in the chest, breathlessness, palpitations, etc. Rheumatic fever needs to be treated by antibiotics to eliminate group A Streptococcus infections.
___is a process that tells cells to stop dividing if they touch each other.
Answer:
Contact inhibition
Using the data provided, how can we describe the difference between amplitude of an average wave in location B?
Compared to location A, an average wave in location B
A.
has more distance between it and the next wave.
B.
has less energy.
C.
is higher from the bottom to the top of the wave.
D.
has less distance between it and the next wave.
Answer:
has less distance between it and the next wave
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years?
A.
The Grand Tetons will stay exactly the same as they are today.
B.
The Grand Tetons will become steeper and more rugged.
C.
The Grand Tetons will become less steep and more rounded.
D.
The Grand Tetons will become much taller than they are today.
Answer:
the correct answer to the question in c
Answer: C)The Grand Tetons will become less steep and more rounded.
Explanation:
How will weathering and erosion most likely affect the Grand Tetons over the next 9 million years? C)The Grand Tetons will become less steep and more rounded.
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
Which relationship is an example of commensalim?
18. Viruses are considered
because they can not perform the characteristics of life without a
19. Viruses are made of two basic compounds,
and a
made of protein.
20. A virus infects a cell by injecting
into a cell.
Answer:
6. antibodies and DNA for the question no.6
How does sexual reproduction increase the variance of traits in a population?
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
an atom that has gained or lost one or more electrons
This is called an ion. :)
what in your dna are responsible for determining the traits that are expressed in an organism
1. mutagens
2. replication
3. cell
4. gametes
5. genes
6. meiosis
Answer:
Genes
Explanation:
Gene. A segment of a DNA molecule (a sequence of bases) that codes for a particular protein and determines the traits (phenotype) of the individual. A gene is the basic unit of heredity in a living organism.
Which of the following describes a negative feedback loop?
Answer:
Which of the following describes a negative feedback loop?
Explanation:
where is option ?
Which of these species might be classified as a pioneer species ? A.Choke cherry B.ponderosa pine C.Aspen D. Lichen
Answer:
aspen
Explanation:
Answer:
lichen
Explanation:
they are the first to grow on bear rock
What phase is mitosis in
Answer:
prophase, prometaphase, metaphase, anaphase, and telophase.
Explanation:
Which statement best describes Mendel's principle of segregation?
Answer:
Inherited traits are controlled by two factors that separate during reproduction.
Explanation:
15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations
Answer:
C. Somatic
Explanation:
hope it helps ya :D
What is the net ATP gain at this stage of cellular respiration?
2
4
32
36
Answer:
The answer is A.) 2, Edge 2022
Explanation:
The net ATP gain at this stage of cellular respiration is 36. Therefore, option "D" is correct.
What is cellular respiration?A series of chemical reactions known as cellular respiration breaks down glucose into ATP, which can be used as energy to power numerous body processes. Cellular respiration has three main stages: the citric acid cycle, glycolysis, and oxidative phosphorylation.
In eukaryotes, the 4 phases of cell breath incorporate glycolysis, progress response (pyruvate oxidation), the Krebs cycle (otherwise called the citrus extract cycle), and oxidative phosphorylation through the electron transport chain.
Therefore, cellular respiration is the main process that generates ATP and gives energy to the body to work.
Learn more about cellular respiration, here:
https://brainly.com/question/29760658
#SPJ7
4.
What is the importance of biodiversity to humans and to ecosystems?
Answer:
Ecological life support- biodiversity provides functional ecosystem that supply oxygen, clean air and water, pollination of plants, pets, control, wastewater treatment and many ecosystem services.
Explanation:
looked it up
why would an athlete need to be concerned about a twitch or sustained contraction
Answer:
why an athlete would need to be concerned about twitches or contractions is because, whenever they perform, and such thing happens, it will most likely distract the athlete, and cause the athlete doing his/her performance to not be as good, and may lead to failure, for example, when someone is running very fast for a sprinting race, and he has a contraction in his leg it will cause him to react by showing signs of pain by slowing down or even tripping and falling, causing him to lose the race.
Hope this Helped!