How many solutions does the following system of linear equations have?

2x-3y = 4
4x - 6y = 8

Answers

Answer 1

The given system of linear equations; 2x-3y = 4, 4x - 6y = 8 has infinitely many solutions.

To determine the number of solutions the system of linear equations has, we can analyze the equations using the concept of linear dependence.

Let's rewrite the system of equations in standard form:

2x - 3y = 4   ...(1)

4x - 6y = 8   ...(2)

We can simplify equation (2) by dividing it by 2:

2x - 3y = 4   ...(1)

2x - 3y = 4   ...(2')

As we can see, equations (1) and (2') are identical. They represent the same line in the xy-plane. When two equations represent the same line, it means that they are linearly dependent.

Linearly dependent equations have an infinite number of solutions, as any point on the line represented by the equations satisfies both equations simultaneously.

To know more about system of linear equations refer here:

https://brainly.com/question/20379472#

#SPJ11


Related Questions

Please someone help with this

I’v been stuck on it all day

By the way I have already been sent that link that hacks you

Just show the work

Answers

ok, i will help you.

For the first equation, we have points

(-1, -4)

and

(1, -1)

we also know the y-intercept is

(0, -2)

we can make systems of equations to solve for the equation of this exponiental function

y=ab^x

-1=ab

-2=a*1

a=-2

-1=-2(b)

b=1/2

The exponiental fufnction here is y=(-2)(1/2)^x

2nd equation

(0, 6)

(1, 12)

12=ab

6=a*b^0=6

a=6

12=6(b)

b=2

2nd equation is

y=6(2)^x

Using the rate of Rs 105 per US Dollar, calculate
the US Dollars for Rs 21000.​

Answers

Answer:

Hey Aryabd interested to talk with me. Come in comments.

The  US Dollars for Rs 21000 would be 200 USD

What is the fundamental principle of multiplication?

Multiplication is the mathematical operation that is used to determine the product of two or more numbers. If an event can occur in m different ways and if following it, a second event can occur in n different ways, then the two events in succession can occur in m × n different ways.

We are given that  the rate of Rs 105 per US Dollar,

We have to calculate the US Dollars for Rs 21000.​

105 Rs = 1 USD

21000 Rs = x USD

Now the proportion can be;

105x =21000

x =21000 /105

x= 200 USD

Learn more about multiplications;

https://brainly.com/question/14059007

#SPJ2

1. The values, x in a sample of 15 are summarized as follows
Σ(x-c) = 72,Σ(x-c)2 = 499.6
where c is a constant. Given that the sample mean is 104.8.
(a) Find the value of constant c.
(b) Find the variance of x.​

Answers

Answer:

(a) 100

(b) 10.27

Step-by-step explanation:

We are given  

No of elements = 15  

Σ(x-c) = 72,Σ(x-c)^2 = 499.6

,where c is a constant

and the sample mean is 104.8.

(a)  lets take into account Σ(x-c) = 72

this means that we have the sum of the 15 elements of x and each element of x is subtracted by the constant c

so the equation becomes Σxi -15c = 72, ............(1)

where xi means the sum of the elements of x from 1 to 15.

we are given the mean as 104.8

this means that Σxi/15 = 104.8

Σxi = 15*104.8 = 1572 .............(2)

substituting (2) in (1)

we get  

1572 - 15c = 72  

15c = 1500  

c = 100

(b) We will use the property that variance does not change when a constant value is added or subtracted to the elements. This we can observe in the given equation that c is a constant that has the value of 100.

so the variance is  

σ^2 = Σ(x-c)^2/15  - (Σ(x-c)/15 )^2

      = 499.6/15  - (72/15)^2

      = 33.31 - 23.04

   σ^2   = 10.27

Therefore the variance of the given problem is 10.27.

The integral ſ sin(x - 2) dx is transformed into ', g(t)dt by applying an appropriate change of variable, then g(t) is: g(t) = cos (33) g(t) = sin (5) This option This option g(t) = cos (3 g(t) = sin This option

Answers

The integral oſ sin(x - 2) dx is transformed into g(t)dt by applying an appropriate change of variable is g(t) = sin(t).

To transform the integral ∫sin(x - 2) dx into the form ∫g(t) dt using a change of variable, we can let u = x - 2.

Then, differentiating both sides with respect to x gives du = dx.

Substituting these values in the integral, we have:

∫sin(x - 2) dx = ∫sin(u) du

The integral has now been transformed into the integral of sin(u) with respect to u, denoted as g(t) dt.

Therefore, g(t) = sin(t).

So, the correct option is g(t) = sin(t).

To know more about integral click here:

https://brainly.com/question/31059545

#SPJ4

cars that are ready for shipping weigh 2 tons. a car being built weighs 1,135 pounds. how much more weight, in pounds, will be added to the car so it will be ready for shipping​!?!

Answers

2,865 pounds will be added

Triangle CDE, with vertices C(-8,-7), D(-2,-8) and E(-5,-2), is drawn on the coordinate grid below.
What is the area, in square units, of triangle CDE?

Answers

Answer:

Area = 24.75 sqr units

Step-by-step explanation:

You will need these formulas:

[tex]d = \sqrt{(x_2 - x_1)^2 + (y_2-y_1)^2}[/tex]

Midpoint = [tex](\frac{x_{1} + y_{1} }{2} , \frac{x_{2} + y_{2} }{2})[/tex]

Area = b x h

Let us treat CD as the base. Find the length of the base with the distance formula. Use the coordinates for points C & D.

[tex]d = \sqrt{(-2 - (-8))^2 + (-8-(-7))^2}[/tex]

[tex]d = \sqrt{37}[/tex]

The base is [tex]\sqrt{37}[/tex].

The height is the distance between point E and the midpoint of line CD.

Midpoint of CD = [tex](\frac{-8 + (-7) }{2} , \frac{-2 + (-8) }{2})[/tex] = ([tex]-\frac{15}{2}[/tex], [tex]-5[/tex])

Use the distance formula to find the height.

[tex]d = \sqrt{(-5 - (-\frac{15}{2} ))^2 + (-2-(-5))^2}[/tex]

[tex]d = \frac{\sqrt{61} }{2}[/tex]

Find the area with the two distances that were found.

Area = [tex](\sqrt{37}) (\frac{\sqrt{61} }{2})[/tex]

Area = [tex]\frac{\sqrt{2257} }{2}[/tex]

Area = 24.75 sqr units

task 1
Find the surface area of the Trumpet.

Answers

The surface area of the trumpet is [tex]\( 1256.64 \pi \)[/tex] square feet.

To find the surface area of the trumpet, we need to calculate the areas of the curved surface and the base separately, and then sum them.

The curved surface area of a truncated cone can be calculated using the formula:

[tex]\[ CSA = \pi \times (r_1 + r_2) \times l \][/tex]

Where [tex]\( r_1 \) and \( r_2 \)[/tex] are the radii of the two bases, and [tex]\( l \)[/tex] is the slant height of the truncated cone.

Given that the base diameter is [tex]40[/tex] feet, the radius of the larger base [tex](\( r_1 \))[/tex] is half of that, which is [tex]20[/tex] feet. The slant height [tex](\( l \))[/tex] can be calculated using the Pythagorean theorem:

[tex]\[ l = \sqrt{(h^2 + (r_1 - r_2)^2)} \][/tex]

The height [tex]h[/tex] of the truncated cone is [tex]30[/tex] feet, and the radius of the smaller base [tex](\( r_2 \))[/tex] can be calculated as half the diameter, which is [tex]10[/tex] feet.

Substituting the values into the equations:

[tex]\[ l = \sqrt{(30^2 + (20 - 10)^2)} = \sqrt{(900 + 100)} = \sqrt{1000} = 10\sqrt{10} \]\[ CSA = \pi \times (20 + 10) \times (10\sqrt{10}) = 30\pi\sqrt{10} \][/tex]

The base area of the truncated cone is the area of a circle with radius [tex]\( r_1 \):\[ BA = \pi \times r_1^2 = \pi \times 20^2 = 400\pi \][/tex]

Finally, we can find the total surface area by adding the curved surface area and the base area:

[tex]\[ Surface \, Area = CSA + BA = 30\pi\sqrt{10} + 400\pi \][/tex]

[tex]\[ Surface \, Area = 30\pi\sqrt{10} + 400\pi \]\[ Surface \, Area = \pi(30\sqrt{10} + 400) \]\[ Surface \, Area \approx 1256.637 \pi \]\[ Surface \, Area \approx 1256.64 \pi \][/tex]

Therefore, the simplified surface area of the trumpet is approximately [tex]\( 1256.64 \pi \)[/tex] square feet.

For more such questions on surface area:

https://brainly.com/question/16519513

#SPJ8

what is the equation of the line that passes through the point (-6,-6) and has a slope of 2/3?

Answers

Answer:

-6=2/3*-6

Step-by-step explanation:

y=mx+b

slope = m b=y intercept

PLEASE HELP!!
In a right triangle, the length of one of the sides is 13.7, while one of the other sides measures 14.3. Find the length of the hypotenuse.

Answers

The length of the hypotenuse is approximately 19.8 units.

In a right-angled triangle, the hypotenuse is the longest side, and it is opposite to the right angle. To find its length, we can use the Pythagorean theorem, which states that in a right-angled triangle, the square of the length of the hypotenuse is equal to the sum of the squares of the lengths of the other two sides. Therefore, we have:

h^2 = 14.3^2 + 13.7^2

h^2 = 204.49 + 187.69

h^2 = 392.18

h = sqrt(392.18)

h ≈ 19.8

We can round the answer to one decimal place, as this is the nearest level of precision to the data provided. Note that for a right-angled triangle, the hypotenuse is always the longest side, so it makes sense that the hypotenuse is longer than both of the other sides in this case.

For such more questions on hypotenuse

https://brainly.com/question/2217700

#SPJ8

Jim and three friends shared 2 poster boards for an art project. What part of the construction paper will each friend get? *

Answers

Answer: 1/2 of a sheet

Step-by-step explanation:

2 sheets divided by 4 people

2/4

Simplify to 1/2

Use the Linear Approximation to estimate Δꜰ=ꜰ(3.5)−ꜰ(3) ꜰᴏʀ ꜰ(x)=41+x2 (Use decimal notation. Give your answer to five decimal places.)
Δf≈ help (decimals)
Calculate the actual change.
(Use decimal notation. Give your answer to five decimal places.)
Δf = help (decimals)
Compute the error and the percentage error in the Linear Approximation.
(Use decimal notation. Give your answer to five decimal places.)
Error = help (decimals)
Percentage error = % help (decimals)

Answers

To estimate Δf = f(3.5) - f(3) using the linear approximation, we'll use the formula:

Δf ≈ f'(a) * Δx

where f'(a) represents the derivative of f at the point a, and Δx represents the change in the x-values.

Given that f(x) = 41 + [tex]x^2[/tex], we can calculate the derivative as:

f'(x) = 2x

Now, let's calculate the values step by step:

Calculate Δf:

Δf ≈ f'(a) * Δx

Δf ≈ f'(3) * (3.5 - 3)

Δf ≈ 2(3) * (3.5 - 3)

Δf ≈ 6 * 0.5

Δf ≈ 3

Calculate the actual change:

To calculate the actual change, we need to evaluate f(3.5) and f(3) separately:

f(3.5) = 41 +[tex](3.5)^2[/tex]

f(3.5) = 41 + 12.25

f(3.5) = 53.25

f(3) = 41 + [tex](3)^2[/tex]

f(3) = 41 + 9

f(3) = 50

Δf = f(3.5) - f(3)

Δf = 53.25 - 50

Δf = 3.25

Calculate the error and the percentage error:

Error = |Δf - Δf_approx|

Error = |3.25 - 3|

Error = 0.25

Percentage error = (|Δf - Δf_approx| / Δf) * 100

Percentage error = (0.25 / 3.25) * 100

Percentage error ≈ 7.69%

So, the results are as follows:

Δf ≈ 3

Actual change (Δf) ≈ 3.25

Error ≈ 0.25

Percentage error ≈ 7.69%

Learn more about Linear Approximation here:

https://brainly.com/question/30403460

#SPJ11

please help please it would me me sm <3

Answers

Answer:

25

Step-by-step explanation:

4x25=100

100-25=75 degrees

Answer:

25°

Step-by-step explanation:

(4x-25)=75

4x=100

x=25

A 20-inch television screen has a width of 12 inches. What is the length of the television screen?

Answers

The answer will have to be x=16

Write your answer in simplest form 11/12- 3/4

Answers

Answer: 1/6 is its simplest form :)

MARKING BRAINLIST ASAPP pleaseee help

Answers

Answer:38

Step-by-step explanation:I think it's 38 because it said right 8 and down 15 so it's kinda like a grid right mean stay positive but also means it goes up so I did 45 plus 8 which is 53 minus 15 which is 38. Hope this gets brainliest

The science and technology class is studying robotics. One group builds a robot that can be controlled by entering positive and negative numbers into a control unit. Negative numbers make the robot roll backwards a specific number of inches. Positive numbers make it move forward a certain number of inches. For example, if −5 is entered, then the robot moves backwards 5 inches. The students enter the numbers −37, +22, and −16. What number do they need to enter to make the robot return to its original position of 0?

Answers

To achieve this, the students must enter +31 (forward) to bring the robot back to its starting position of 0.

The robot can move forward or backward depending on the type of number entered into the control unit. For example, entering a negative number causes the robot to roll backward a specific number of inches,

while entering a positive number makes it move forward a certain number of inches. If −5 is entered, the robot moves backwards by 5 inches. As a result, the students entered the numbers −37, +22, and −16 to move the robot.

The question asks what number needs to be entered to bring the robot back to its starting position of zero. To do so, we must first calculate how far the robot has traveled in total.

When a negative number is entered into the control unit, the robot rolls backward.

As a result, when we add the negative numbers and subtract them from the positive number,

we can determine the total distance traveled by the robot.-37 (back) + 22 (forward) - 16 (back) = -31 (inches traveled)Since the robot moved a total of 31 inches,

the students must enter the opposite number to bring the robot back to its starting position of 0.

To learn more about : starting position

https://brainly.com/question/28815991

#SPJ8

Let D be the region bounded by the two paraboloids z = 2x2 + 2y2 – 4 and z=5 - x2 - y2 where x > 0 and y > 0. Which of the following triple integral in cylindrical coordinates allows us to evaluate the volume of D? - √3 5-2 Salon dzdrde None of thes

Answers

Option D is the correct choice.

To evaluate the volume of D, the triple integral in cylindrical coordinates is required. So, let's derive the required triple integral.

Region D is bounded by two paraboloids z = 2x2 + 2y2 - 4 and z = 5 - x2 - y2 where x > 0 and y > 0.

In cylindrical coordinates,r = √(x^2 + y^2)z = zθ = tan-1(y/x)For the first paraboloid, the cylindrical equation of the paraboloid is: z = 2x2 + 2y2 - 4

By substituting the cylindrical coordinates values in this equation we get z = 2r2 sin2θ + 2r2 cos2θ - 4z = 2r2 (sin2θ + cos2θ) - 4z = 2r2 - 4 Now for the second paraboloid, the cylindrical equation of the paraboloid is: z = 5 - x2 - y2By substituting the cylindrical coordinates values in this equation we get:z = 5 - r2 The limits of r are 0 and √5; and the limits of θ are 0 and π/2.

Finally, the limits of z are obtained by equating the above two paraboloids.2r2 - 4 = 5 - r22r2 + r2 = 9r2 = 3z = 3We have got all the limits of cylindrical coordinates, we can now write the triple integral in cylindrical coordinates which evaluates the volume of D.

The triple integral is:∫(0 to π/2)∫(0 to √5)∫(2r2 - 4 to 3) r dz dr dθ

Learn more about integral at: https://brainly.com/question/32512899

#SPJ11

Cindy lost 28 pounds while on a diet. She now weighs 157 pounds. Write and solve an equation to find her initial weight

Answers

Answer:

The equation is 157+28=185.

157+ 28= 185

I think that’s right

please helpppp which function h(x) results when g(x) is translated 7pi/8 units right and one unit down????

Answers

Answer:

The second option

Step-by-step explanation:


BRAINLY TO WHOEVER HELPS AND GETS IT RIGHT

~no links pls~

Answers

Answer:

the answer is C

Step-by-step explanation:

BABYSHARK

Answer:

I think its c?

Step-by-step explanation:

Hope this helps and have a wonderful day!!!

What is k^2+16k+64+89

Answers

Answer:

k²+16k+ 153

Step-by-step explanation:

k²+16k+64+89

= k²+16k+ 153

Help Please! Find The Area Of A Circle With D=8.2

Answers

Answer:

52.81

Step-by-step explanat


You must estimate the mean temperature (in degrees Fahrenheit)
with the following sample temperatures:



79.5


102.8


80.8


76.8


80.4


79.2


86


67.7



Find the 98% confidence interval. Enter your answer as an open-interval (i.e., parentheses) accurate to two decimal places (because the sample data are reported accurate to one decimal place). * Answer should be obtained without any preliminary rounding.

98% C.I. =

Answers

The interval value at 98% confidence level for the given scenario is (73.51 ; 89.79)

From the data :

Mean(x) = (79.5+102.8+80.8+76.8+80.4+79.2+86+67.7)/8

Mean = 81.65

Sample standard deviation :

s = √[(x1 - mean)² + (x2 - mean)² + ... + (x(n) - mean)²] / n

Using a statistical calculator :

s = 9.98

The confidence interval is defined thus :

Mean ± Tcritical × s/√n

Tcritical at 98% = 2.306

Substituting values into the formula :

81.65 ± (2.306 × 9.98/√8)

81.65 ± 8.137

(73.51, 89.79)

Therefore, the confidence interval for the given scenario is (73.51 ; 89.79)

Learn more on confidence interval :https://brainly.com/question/15712887

#SPJ4

For matrices: A = -1-41] 0 2 2 2 30] B = 33 -1 2 A. What is the dimension of A and B? B. What is the dimension of A B? C. What is A'B?

Answers

A. the dimension of A is 3x3. the dimension of B is 3x2.

B. the dimension of AB will be 3x2.

C. The value of AB = [[ -15 14] [ 4 -2] [ 13 -9]]

A. The dimension of a matrix is given by the number of rows and columns it has.

For matrix A, we have:

A = [[-1 -4 1], [0 2 2], [2 3 0]]

The matrix A has 3 rows and 3 columns, so the dimension of A is 3x3.

For matrix B, we have:

B = [[2 0], [3 -3], [-1 2]]

The matrix B has 3 rows and 2 columns, so the dimension of B is 3x2.

B. To multiply two matrices, the number of columns in the first matrix must be equal to the number of rows in the second matrix. In this case, A has 3 columns and B has 3 rows, so we can multiply them.

The dimension of AB will be the number of rows of A and the number of columns of B. Therefore, the dimension of AB will be 3x2.

C. [-1 -4 1] * [2 0]

   [0 2 2]    [3 -3]

   [2 3 0]    [-1 2]

  [-2-12-1   0+12+2]

= [0+6-2    0-6+4]

  [4+9+0   0-9+0]

  [ -15     14]

= [ 4         -2]

  [ 13       -9]

The value of AB = [[ -15 14] [ 4 -2] [ 13 -9]]

Learn more about Matrix here

https://brainly.com/question/18575610

#SPJ4

Given question is incomplete, the complete question is below

For matrices: A =[[ -1 -4 1] [0 2 2][ 2 3 0]] B =[[2 0] [3 -3 ][-1 2] ]

A. What is the dimension of A and B?

B. What is the dimension of A*B?

C. What is A*B?


[tex] \sqrt{39} [/tex]
Please help me to find the answer of square root 39
plz​

Answers

Answer:

hi dear friend the answer is 6.245. hope that helps it has been a pleasure to help you can always look out for me if you have a math problem.

I NEED HELP
Please write the right answer
Your portfolio must include a minimum of the following five types of equations and solutions:

Two one-step equations
Two equations that contains fractions
One equation with distributive property
One equation with decimals
One real-world problem that is solved by an equation
Remember that each equation must include at least one variable. Once you have created each equation, you will solve it and show your work. Pretend that you are teaching the equations to a new pre-algebra student. Or you can actually teach them to a sibling or friend!

This is a total of 7 equations and solutions.

Answers

Answer:

1).  (x - 4 = 13)

2).  (r + 17 = 51)

3). (7/9x =28)

4). (2/3x = 2)

5). { 3(x-2) = -9 }

6). (x -1.75 = 8.85)

7). Natalie buys organic almonds priced at $77 from the grocery store. How much did

she pay the cashier, if she received $23 in change?

Step-by-step explanation:

1. add 4 on both sides and it will be x=17

2. subtract 17 on both sides and it will be x= 34

3. multiply 9/7 on both sides and it will be x= 257/7 then you divide 257 by 7 then the final answer will be x= 36

4. multiply 3/2 on both sides and it will be x=6/2 then you divide 6 from 2 and the finial answer will be x= 3

5. you will distribute 3 into x and 2 and you will be 3x-6=-9 then you will add 6 on both sides so you will get 3x=3 and then divide 3 on both side so you will get x=1

6. add 1.75 on both sides so x= 10.6

7. the equation will be 23 +x = 77 so first you will subtract 23 on both sides and x will equal 54 so Natalie paid $54

Answer:

i'm taking that test rn

Step-by-step explanation:

Help on here too plz there’s more in my acc I need help on all

Answers

x=2rad10
y=4rad5

it’s a 45-45-90 triangle so the two legs are the same. the equation for hypotenuse would be h=rad2 x leg. substitute; h=rad2 x 2rad10 = 4rad5

Your customer has found base plates that are defective, they exceed the maximum width dimension of 4.005. As a result the mating component will not fit on these base plates properly. You manufacture these base plates on four identical CNC milling machines with approximately 25% of the production coming from each machine.
Simplified drawing of base plate is shown below.
Assignment:
Your manager has requested you sample 50 pieces from the manufacturing floor that were manufactured from each machine, analyze the data and come up with recommendations to solve the problem. (The data for the 50 piece sample is attached at the end of the assignment.)
Introduction: describing the process and statement of the general problem(s)
Analysis of the data: Graphical analysis is required
Each table and graph must be briefly explained at the point of the table or graph to indicate how it relates to the study at hand.
A brief summary of the findings relating back to specific analytical tools
Cause and effect diagram(s): identifying PERTINENT possible solutions to the problem(s)

Answers

The problem at hand involves base plates that exceed the maximum width dimension, resulting in improper fitting of the mating component. To address this issue, a sample of 50 base plates manufactured from each of the four CNC milling machines was analyzed.

Graphical analysis of the data revealed insights into the problem. Recommendations for solving the problem include identifying pertinent possible solutions through cause and effect diagrams.

The analysis of the sample data from each CNC milling machine provides valuable insights into the issue of base plates exceeding the maximum width dimension. By graphically analyzing the data, patterns or variations can be identified, helping to pinpoint the specific source of the problem. This analysis may involve creating graphs or tables to visualize the measurements and compare them across the machines.

To identify possible solutions, cause and effect diagrams, such as fishbone diagrams, can be utilized. These diagrams help to identify potential causes of the issue by categorizing them into different categories such as machine factors, material factors, human factors, and environmental factors.

Learn more about graphs here:

https://brainly.com/question/17267403

#SPJ11

helppppppppppp meeeeeeeeeee

Answers

Answer:

It's 11.72

Step-by-step explanation:

Area=)1/2×15/4×25/4

Answer》11.72

Hope it helps...

Have a great day

Answer:

i have made it in above picture

1. What is the domain of
f (x)= 9 - x?

Answers

Answer:

theres no answer

Step-by-step explanation:

Other Questions
Please help me Im timed Find the general solution of the nonhomogeneous differential equation, 2y""' + y" + 2y' + y = 2t2 + 3. Fill in each box below with an integer or a reduced fraction. (a) log 16: = 4 can be written in the form 24 = B where A = and B = (b) log, 125 = 3 can be written in the form 5C = D where C = and D= = Aman Private School is a new Integrated School just operating at Puncak Alam. Since the school is still new, the policy of the fee collection is only by cash payment. The process of fee payment for these 2 months is as follows: Miss Huda is an account clerk who will receive the cash fee payment made by the parents every day. She will issue the original receipt of payment to respective parents and cash collected is kept in the locked drawer near her place. The copy of the receipts then will be stored in the collection file. At the end of the school hours, she will count the cash and prepare the daily report that shows the fee details to ensure it is tally with the daily receipts issued. Normally, the total cash received every day is around RM 1,000 and above, and it can be 5 times higher at the beginning of the new month. Encik Zaki, the account assistant will make a cash deposit to the bank in the next following days. The bank in slips will be attached to the daily report after the deposits were made. The daily report will be used by Puan Aina to record in the MYOB Accounting System every week. She also prepares bank reconciliation every two months and authorized by Encik Mohd as Head of Account Department. Required: Assess any four (4) weaknesses in the internal control system in Aman Private School in situations in which there are substantial economies of scale, the ___________ of adding an additional customer is very _________ once the fixed costs of the overall system are in place.a. average variable cost, high b. marginal cost, low c. marginal revenue: low d. marginal cost; high A part of a sequenced chromosome has the sequence on one strand) ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG Enter the longest part of this sequence that is most likely to take up the Z conformation. ATTGCATCCGCGCGTGCGCGCGCGATCCCGTTACTTTCCG sequence: Incorrect Public-key encryption is based on a ____.a.message authentication code (MAC)c.hash valueb.certificated.key The total population of the United States exceeds 328 million people. Many transactions each day are needed to feed, clothe, and shelter a population of this size. The number is huge. It all works because the US economic system distributes the output of farms and factories. This example shows that ___________. a. marketing is important to business b. marketing dominates supply chain activities c. distribution is the focus of marketing d. distribution is not part of marketing activities select all of the following that would be soluble in the dichloromethane layer of an extraction that utilizes water and dichloromethane as its liquid layers: group of answer choices cyclopentane sodium chloride ethoxypropane methylcyclohexane lithium acetate Which of the following is an example of foreign direct investment in China? A.Chinese Shenzen Airlines company buys a small U.S. midwest airline company, Air Chicago. B.A U.S. foreign exchange speculator buys $200,000 worth of the Chinese currency the yuan. C.U.S. auto entrepreneur Elon Musk buys stock in Alibaba Group Holding Limited of Hangzhou, China. D.The U.S. company Walmart buys a warehouse in Shanghai. E.The bank of China purchases U.S. Treasury bonds. Comment on the significance of each concept in terms of the role it plays in helping us to understand the nature of international economic relations.1. Internal economies of scale.2. A carbon tariff.3. The real exchange rate. Police infotainment tends to privilege which criminal justice frames? T/F. robust australopithecines had large chewing muscles but lacked a sagittal crest. how many moles of NH, will be produced if 3.5 moles of N2, are reacted completely You have configured your switches with the spanning-treevlan x root primary and spanning-tree vlan x rootsecondary commands. Which of the following tertiary switchwill take over if both switches fail?A. A switch with priority 4096B. A switch with priority 8192C. A switch with priority 12288D. A switch with priority 20480 increased collections is a benefit of a multidisciplinary approach to rcm? use the quadratic formula to find the exact solutions of x2 5x 2 = 0. the shoe co. manufactures and sells two lines of shoes. during the most recent accounting period, the black line and the brown line sold 15,000 and 2,000 units, respectively. the company's most recent financial statements are shown below: black brown sales $ 900,000 $ 240,000 less cost of goods sold: unit-level production cost 600,000 135,000 depreciation, production equipment 125,000 50,000 gross margin $ 175,000 $ 55,000 less operating expenses: unit-level selling and administrative costs 40,000 65,000 corporate-level facility expenses (fixed) 36,000 36,000 net income (loss) $ 99,000 $ (46,000 ) based on this information, the company should: a. keep the brown line because it contributes $55,000 to total profitability. b. eliminate the brown line because it is operating at a loss. c. keep the brown line because it contributes $40,000 to total profitability. d. it is impossible to determine with the given information. we need to know the number of products we have in the purchaseorderdetail table. (count the number of un-repeated productid) 8. (5 pts) what is (0.00034) x 48579? make sure the reported answers is rounded properly. a) 16.5 b) 17 c) 16.517 d) 16.52