How red blood cell adapt to function

Answers

Answer 1

Answer:

Red blood cells haveadaptations that make them suitable for this: they contain haemoglobin - ared protein that combines with oxygen. they have no nucleus so they can contain more haemoglobin. they are small and flexible so that they can fit through narrow blood vessels.

Explanation:

Hope It Helps


Related Questions

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

what do you mean by mental labour​

Answers

Answer: Mental Labour, According to this definition, mental work refers to planning, organizing, coordinating, and managing duties and tasks that we perform during the course of our lives. People's worries about their ability to manage their time efficiently and effectively.

Explanation:

I explained at the top-

what is photo synthesis?​

Answers

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical

Please help me with this

Answers

Answer:

bro ineed help to

Explanation:

Answer:

option 1 is the crt answer

Explanation:

B and j show more dna similarity as B is the direct ancestor of j

Which process comes first in the process of protein synthesis?
A. Transcription

B. Translation

Answers

Answer:

A. Transcription

Explanation:

Transcription comes first in the process of protein synthesis.

Answer:

A.Transcription

Explanation:

Transcription is the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.

Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.

B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.

C. Scientists breed cows that give greater amounts of milk than their ancestors.

D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.

E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.

Answers

Answer:

The Answer is C

Explanation:

When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.

Answer:

C. Scientists breed cows that give greater amounts of milk than their ancestors.

Explanation:

The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.

When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of

Answers

This supports the theory or mendal law of evolution bc the chromosomes Are aligned together

Which equation summarizes the process of respiration​

Answers

Explanation:

i hope this helps you ok like

Which sample formed from the solidification of lava near Earth's surface

Answers

Answer: Granite and Basalt


Explanation: Igneous rocks (from the Latin word for fire) form when hot, molten rock crystallizes and solidifies. The melt originates deep within the Earth near active plate boundaries or hot spots, then rises toward the surface. So in this case it would be Granite and Basalt

Once mRNA is made it travels

A. out of the cytoplasm, into the nucleus where a ribosome will attach to it.

B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Answers

Answer:

B. out of the nucleus, into the cytoplasm where a ribosome will attach to it.

Explanation:

Once mRNA is made, it travels out of the nucleus, into the cytoplasm where a ribosome will attach to it.

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)

DNA acts as a _____________ for living things
A. map

B. blueprint

Answers

Answer:

A. map

Explanation:

DNA acts as a map for living things.


Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.

Answers

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

What do you mean by predators ?

Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.

Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.

Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.

Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).

Learn more about  predators click here:

https://brainly.com/question/29779690

#SPJ1

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."


1. Osmosis and diffusion are same phenomena.​

Answers

Answer:

they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'

Explanation:

Answer:

Explanation:

Not the same

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

Which of the following is a subsystem of an organism?

Answers

You didn’t post all of it

In 2012, excitement rippled through the scientific community with the discovery of an enzyme that appeared to be, just maybe, a powerful new tool for combating Alzheimer’s. At the Mayo Clinic in Florida researchers identified a gene, BACE2, which appeared to destroy beta-amyloid — a protein, then understood to be toxic, which is found in clusters in the brains of people living with Alzheimer’s. Alzheimer's is often diagnosed by measuring the amount of buildup of this protein. A large amount of it is an indicator of the disease. People with this buildup often do not have enough of the BACE2 enzyme created naturally in their body. If a way to synthesize this enzyme artificially or to prompt the body to create more were discovered, it could be hailed as a cure for Alzheimer's. How does the BACE2 enzyme work?

Answers

Answer:

BACE2 cuts both beta-amyloid and beta-amyloid precursor protein.

Explanation:

What makes BACE2 so effective in fighting Alzheimer's is its efficiency in cutting both beta-amyloid and the protein that develops it. There are other enzymes, which have the ability to break down beta-amyloid, but BACE2 is the only one that breaks it down into such small pieces that it completely destroys it. Furthermore, BACE2 is able to break down the beta-amyloid precursor protein, which prevents the formation of beta-amyloid from taking place.

Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog

Answers

Answer:

Beatle

Explanation:

Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

What is Food Web?

A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.

A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.

In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.

Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

Learn more about Food Web, here:

https://brainly.com/question/18816028

#SPJ2

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

Identify the main floral organs
of a flower.

Answers

petals, sepals, stamen, and carpel

Fossils show that some of those extinct organisms evolved into organisms that survived today like _____.
A. ants

B. humans

C. wolves

D. birds

Answers

Answer:

c wolves would be your Excellent answer

Answer:

D. birds

Explanation:

Fossils show that some of those extinct organisms evolved into organisms that survived today like birds.

How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?

Answers

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.

Explanation:

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet

Explanation:

What is the function of the Sebaceous Gland * To produce Sweat
To produce water
To produce natural oils for the skin protection None of the Above​

Answers

Answer:

To produce natural oils for the skin

Explanation:

The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol.

Sebum lubricates the skin to protect against friction and makes it more impervious to moisture

Other Questions
Total area of composite figure HELP ME PLEASEEEEEEEEEEEEEEEEE 5x + 7y = 42 I need to find the xand yintercepts. A guitar factory has a cost of production C(x) = 100x + 56000 , where is the number of guitars produced . If the company needs to break even after 150 units sold, at what price should they sell each guitar ? Use the variable p to represent the price Round up to the nearest dollar . Find F(-5) if f(x)=6 15 cm10 cmo10 cmDiagram NOT accurately drawnThe diagram shows a sector of a circle, centre 0, radius 10 cm.The arc length of the sector is 15 cm.Calculate the area of the sector. ssignment-make sure I can open it.Factor62) Using SYNTHETIC Division, is X = 2 asolution of the polynomial 2x + 3x2 - 11X 6*Show all work just below can someone help me. Who likes fishing here? On the distant planet Cowabunga, the weights of cows have a normal distribution with a mean of 483 pounds and a standard deviation of 70 pounds. The cow transport truck holds 5 cows and can hold a maximum weight of 2840. If 5 cows are randomly selected from the very large herd to go on the truck, what is the probability their total weight will be over the maximum allowed of 2840 pls tell plssssssssssssssssssssssssssss:( PART A: Which of the following best describes the central idea of the article of COOL JOBS: REACHING OUT TO E.T. IS A NUMBERS GAMEA) Math plays a vital role in scientists search for alien life as it helps themdetermine where and when life might exist and communicate with it.b)Math is a language that everyone understands on Earth, and it is likely that mathis the foundation of all alien languages as well.c)While some scientists rely on math to contact aliens, it plays a larger role ingeneral space exploration by helping astronomers get to space.d)While searching for alien life with math is exciting, scientists should be focusingon finding any form of alien life, not just intelligent ones. Jos drove from New York to Florida. Resting for 1 hour for every 5 hours he drove. If he drove for 35 hours how many hours did he rest. The camping group has 24 ppl in all 21 out of 24 would like a smore it takes 1 min and 30 sec to make each one if two ppl are making them at the same time how long will it take to make one for each person can someone please help is 1030 the best rapper to touch down on the underground? Kaj and some friends are going to the movies. At the theater, they sell a bag ofpopcorn for $4.75 and a drink for $3.75. How much would it cost if they bought 6bags of popcorn and 3 drinks? How much would it cost if they bought p bags ofpopcorn and d drinks?Total cost, 6 bags of popcorn and 3 drinks:Total cost, p bags of popcorn and d drinks: BlueA bowl contains: 3 red erasers 4 blue erasers.6 green erasers 7 pink erasersAn eraser will be drawn fromthe bowl and replaced 50 times.What is a reasonable predictionfor the number of times a greeneraser will be drawn? What was one strength of the south heading into the Civil War -2(y-4)=18 PLEASE HELPPPPPPP