Ichabod Crane was said to have "sojourned," or, as he put it, "tarried" in Sleepy Hollow.
Which is the meaning of these words?

Answers

Answer 1

Answer:

It’s number 2

Explanation:

Answer 2

The meaning of the given word that mentioned in the question is to be considered as the resided temporarily.

Meaning of the given word:

A sojourn refers to a temporary stay or visits at a specific place. It is considered to be a short stay.

At the time when people go on a visit, they might say that they sojourned at a place since they're staying there on a temporary basis.

So we can say that The meaning of the given word that mentioned in the question is to be considered as the resided temporarily.

Learn more about word here: https://brainly.com/question/17860610


Related Questions

Match each line from King's speech to the type of rhetorical technique it best shows.
"there are insufficient funds in the
allusion
great vaults of opportunity"
"go back to Mississippi, go back to
Alabama, go back to South Carolina"
repetition
"let freedom ring from every hill and
molehill of Mississippi"
metaphor
"with its vicious racists"
connotation

Answers

Answer:

The answer is shown in the photo

Explanation:

1). There are insufficient funds in the Great vaults of opportunityMetaphor

2). Go back to Mississippi, go back to Alabama, go back to South CarolinaRepetition

3). Let freedom ring from every hill and molehill of MississippiAllusion

4). With its vicious racists⇒ connotation

What is rhetorical technique in a speech?

Rhetorical strategies refers to those words or phrases that are used to convey the meaning to the listener and provoke a response from a him.

These are the strategies, which can be used in writing, in conversation or if you are planning a speech .

Rhetorical strategies offer a way for people to connect with what you're talking about.

Learn more about the rhetorical technique here:-

https://brainly.com/question/23952074

#SPJ2

What word suggests a negative connotation of being thin?
O scrawny
O lean
O slender
O svelte
Help me

Answers

Answer:

Honestly it could be slender or scrawny but I would say scrawny because it would mean that you're "unattractively" bony


Chimpanzees often live close to large bodies of water.
They are not strong swimmers.
even though since until E joining words
Combine the sentences. Use the joining word that best shows the relationship
between the ideas.

Answers

Answer: Even though, chimpanzees often live close to large bodies of water, since they are not strong swimmers.

The joining word which can be used to linked the two sentences together is the word 'even though'.

What is meant by even though?

Even though is referring to the strong word that explains the situation apart from the actual fact. It can be replaced with fewer words, like nonetheless, but, regards, etc. It is used to indicate an act which could be relatable in its actual sense.

The provided two sentences can be joined with the word 'even though' which makes the revised sentence to be written as ' Even though Chimpanzees often live close to large bodies of water, they are not strong swimmers.' The revised sentence tells about the fact that the chimpanzees living near to the water but that doesn't mean they are the strong swimmers.The word 'since' relates to the time which has been gone away and ideally it is referring to the action done in past. The word 'until' also relates to the time which is interpreted as 'up to'.

Therefore, the words until and since are not used in joining the two sentences.

Learn more about the joining words in the related link:

https://brainly.com/question/17019760

#SPJ2

Complete Question:

The complete question should be as follows:

Chimpanzees often live close to large bodies of water. They are not strong swimmers.

Combine the sentences. Use the joining word that best shows the relationship between the ideas.

even though , since , until are the joining words .

When my husband learned his rival had gotten the promotion he wanted, he was ___.

Answers

Answer:

i am sorry for any inconvinience but I cannot help you if there are no choices so I would appreciate if you do so but instead i can give you some words that might fit within the sentence you have provided!

- furious

- infuriated

- annoyed

- fuming

- antagonistic

hope this helps you!

Prompt
Use the following to write a paragraph analyzing the plot of "The Sniper."
1. What is happening as the story begins?
2. List 5 strong adjectives that describe the main character.
3. Specifically describe the setting. List 4 adjectives that describe the environment
4. What is the conflict in the story? What is the Sniper's internal conflict?
5. What is the Sniper's state of mind or attitude throughout the story?
6. What event is the climax of the story? How does this change the mood of the story?
7. What is the resolution of the story? How is the conflict resolved in the story?
8. Describe the situational irony at the end of the story.
9. What is the theme of the story?
10. Why does the author chose not to give the main character a name?

Answers

Answer:

billy

Explanation:

Bobby Joe hamm jammer

The following is a student draft. It may contain errors.
Two weeks before I started high school, my mother announced we would be moving ... to an entirely different city, halfway across the country
Needless to say, I was horrified. I had already arranged for a way to avoid taking the bus carpooling with my friend Kwe and had signed up for all my
classes and extracurricular activities. I was certain this new school wouldn't have nearly as many options, and I knew there was no way I was going to
be able to set up a new carpool with only a few days to meet new people.
I would be moving away. I wondered, what would this new city be like what would the people be like what would people do with their time? I just
couldn't fathom a life outside of the one I knew and so I began to worry about whether I would be able to fit in.
These were the thoughts that haunted me for the next fourteen days, as we packed all our possessions and loaded them into the moving truck, as
we drove two thousand miles across the country, as we settled into our new apartment; and then, as I stood staring at the massive glass doors that
led into the new school I would begin the next day. But as I stood there, hesitant to take another step into this unknown world, I realized something
things are never as bad as I think they will be.
Which sentence is best to add to the end of paragraph 2 to better support the idea that the author is worried about fitting in?
ОА. I was certain everything would be better in the new city, but at the same time I felt like I was leaving my old friends behind to
pursue newer and much more interesting things.
OB. I was excited to learn about the new city we would be moving to including what types of activities were popular there and
whether the other kids enjoyed the same things as people from my hometown.
OC. How could my mother pack up our house and talk excitedly about our supposed new adventure, when all I could think about
was how miserable I felt and how much I would miss my friends?
OD Would the new kids enjoy doing the same things as my friends back home, or would I spend months in some sort of solitary
confinement pursuing my own interests?

Answers

Answer: name the city more at least

Explanation:

what is the important points about relationships through analogies

Answers

Answer:

When children see the relationship between things through analogies, they can then build on that knowledge and learn more about those things. They can discover new ways to use things (e.g., using a broomstick as a pretend horse) and make broader comparisons between things. This can help expand their creativity.

Explanation:

"i cheer for people. i was raised to believe there's enough sun for everyone " write 2 paragraphs of what you think why it has meaning to you, how it might be helpful or relevant to other's.​

Answers

Answer:

dddddddddd

Explanation:

inductive is best defined as

Answers

Answer:

Inductive is most often used to describe a kind of reasoning or logic where general theories are formed

Answer:

Inductive is best defined as characterization by the inference of general laws from particular instances.

Explanation:

An example of inductive reasoning can be used during a sentence such as, "All organisms are made from cells based on past research and experiences."

Should a degree be a basis for qualifying an applicant for a position?

Answers

Answer:

Job requirements are vital, both for employers and job seekers alike. ... This can help to attract qualified candidates to the job listings. When completing their job search, potential applicants may not apply for a position when they aren't sure if they are qualified for the job.

Hope this Helps (✿◡‿◡)

The ratio gold charms to Silver charms is 1:3 which they will not describe this relationship

Answers

what are the answer choices

Answer:

For every silver charm, there is 3 gold charms.

Explanation:

For every silver their is 3 Gold, but that is not true because there is 3 silver to every gold.

Which sentence correctly uses an adverbial phrase?
A. Although he was tired, John hurried.
B. John, a really fast runner hurried.
C. John hurried quickly.
D. John hurried over the hill.

Answers

Answer:

a. Although he was tired, John hurried.

Answer:

correct answer would be D.

Explanation:

Examples of sir gawains successes

Answers

Answer:

He does triumph over that fear insofar as he seeks out the Green Knight, honoring his end of the bargain. However, in taking the girdle, he fails. But perhaps it is the truest hero who learns from his mistakes, for in the end, Sir Gawain realizes and understands where he has failed.

!!HURRY I DONT HAVE MUCH TIME!! Brainstorm some ideas for a “hook” for your essay. (it’s over online schooling , i’m against it) please help me thank you:)

Answers

Answer:

Have you ever attended a meeting online for a max time of one hour and thought it was realy bkring and hard to concentrate? now multiply that by 9. That is how online students everyday feel doing online school. I think that school should be done face to face because first...(and there you put your reason 1 and 2)

The line: "I heard the familiar "jug--jug--SPAT!" of a motorcycle, and a frantic policeman rode alongside" best demonstrates which literary device?

Answers

Answer:

Onomatopoeia.

Explanation:

In the given line, the figurative language which is used is onomatopoeia.

Onomatopoeia is a literary device which is used to create phonetical sounds of any object using words. It mimics the sound by describing them in words. For instance, 'tick-tock' is an onomatopoeia for clock.

In the given line, 'jug-jug-SPAT' is an onomatopoeia used for describing the police motorcycle which followed Gatsby, in the novel 'The Great Gatsby.'

Therefore, onomatopoeia is the correct answer.

Please I need help 100 Points!!!!!
Dont answer whatever to just get points I'm giving all my points
PLEASE HELP!!!

Answers

Answer:

3 A.

4. A

5. B

6 C

7 A.

8 B.

Part A

1 F.

2 C.

3 i.

4 J.

5 G.

6 A.

7 H.

8 B.

9 D.

10 E.

Part b

1  C.

2 a.

The last two are

a.

b.

Explanation:

hope this helps-

finish this

what is love? ... baby

Answers

Answer:

don’t hurt me

Explanation:

The Article states:
As scholar-athletes, Kalambayi and Phillips can bring discipline, great study habits,
and organization to the pros. But does the discipline needed to maintain a strong
academic performance necessarily carry over to the NFL? Not always, some
football experts say.
Which would be the closest synonym for the word maintain, as it is used above?
A
Uphold
B
Defend
с
Reshape
D
Abandon
Kk

Answers

Answer:

B

Explanation:

defend because he is trying to defend himself

what is the English Derivative for the Latin word 'Fibula'?

Answers

Answer:

Fibula – Fibula is the Latin word for a clasp and especially the needle-like clasping part. Evidently, the smaller of the two leg bones was thought to resemble that object.

Read these lines from "My Father Is a Simple Man."

I can always
remember that here was a man
who was a worker and provider,
who learned the simple facts
in life and lived by them

Which word best matches the connotative meaning of simple as it is used in these lines?

real and uncomplicated

less sophisticated

innocent and pure

lacking intelligence

Answers

Answer:

A. Real and uncomplicated.

Explanation:

'My Father is a Simple Man' is a poem written by Luis Omar Salinas. The poem  begins with a son and father taking a walk and talking about deeper meaning of life.

In the poem, the speaker calls his father 'a simple man' who learned 'simple facts in life.' By using the term simple, the speaker connotatively is referring to 'real and uncomplicated.' The speaker is stating that his father learned the real and uncomplicated facts in life and was a real and uncomplicated person.

Therefore, the correct answer is A.

Answer: For k12 users "Something that produces a sense of well-being"

Explanation: Hope this helps

A metaphor compares two things without using like or as

Answers

Answer:

true

Explanation:

Please mark brainliest

Yea that is correct hope u do good

If you answer I will give 21 points no cap

Answers

Answer:

y=x+9

Explanation:

starts at 9 and goes up and to the right 1

Answer:

y=x+9

Explanation:

Which sentence best describes how the narrator's point of view affects the story?
O 1. It gives the reader a better understanding of why the main character is captured.
2. It enables the reader to sense the people's fear when the main character yells at them.
3. It provides the reader with information about the story's events from a neutral perspective.
04. It allows the reader to discover what the main character thinks and feels while being tied up.

Answers

4. It allows the reader to discover what the main character thinks and feels while being tied up.

Answer:

hope this helps :)!!!

the answer is  It allows the reader to discover what the main character thinks and feels while being tied up.

Explanation:

One of the best inventions to capture images in space was placed in Eartis orbit in 1990 and is
there ty
)
A
Telescope V
B)
Newton Telescope
Galileo Telescope
D)
Hubble Space Telescope

Answers

Answer: Hubble Space Telescope

Explanation:

The Hubble Space Telescope is simply a big telescope that is in space. The Hubble Space Telescope was launched in 1990 and orbits above the surface of the Earth at about three hundred and forty miles.

Hubble Space Telescope is typically powered by solar and can be used by astronauts or other scientists to take puctires of the galaxies or planets.

(ELA) Which part of an opinion essay should sum up your entire argument?

A. conclusion
B. introduction
C. evidence
D. reasons

Answers

the answer is A because the intro is the beginning nd the reason in evidence is in the middle so it’s. A

What is the purpose of using subheadings as a text feature in your writing?

A. increases reading comprehension
B. introduces new information
C. organizes the information
D. condenses the essay
E. describes keywords to know

Answers

Answer:

E. describes keywords to know.

Answer:

B: introduces new information, C: organizes the information, E: describes keywords to know.

( if im wrong, im sorry)

Explanation:

Write sentences that show how Langston Hughes and Countee Cullen are alike and how they are different Use transitional words and phrases that signal comparison and contrast.​

Answers

Answer:

Langton Hughes was a famous African American poet of the Harlem Renaissance. Countee Cullen was a famous African American poet of the Harlem Renaissance too. Langton Hughes was born in 1902 in Joplin, Missouri. Countee Cullen was born in 1903 in Louisville, Kentucky.  

Explanation:

I got this answer because I did what the question said for me to do and the question said for me to write sentences so I wrote 4 sentences and to have them say one thing alike with Langston Hughes and Countee Cullen and to have them say one thing different, using transitional words and phrases that signal comparison and contrast and I did that. That's why my answers right.

How do the actions of Vieja Sabía help you determine the theme of the play?

Answers

Answer:

Judgment. Action. Comprehension. Genre. A Play is a story told entirely ... help you to evaluate Ranita, the Frog Princess? ... them to tell where Scene 1 takes place and to identify the characters' ... two tales with a common theme and compare and contrast them ... Vieja Sabia: You wouldn't be a frog if you hadn't refused to.

Explanation:

essay on games and sports​

Answers

Answer:

Tips for Writing a Sports Essay

First and foremost, talk about a game you are interested in, or you know about. ...

Next, choose the topic wisely. ...

State important facts about the game. ...

Describe the game plan and strategy which was used in the last game.

Explanation:

ANSWER CORRECTly or banned

Make this essay better


Komodo Dragons are monsters. These beasts are monsters when they are not trained, and most of them are not. Most of them are not trained because they most likely don't have owners or a human to train them, sometimes even if they do, the humans do not get to train them.
One reason these Komodo Dragons are beasts is because they sit in the sun all the time and if your dog is walking around and a Komodo Dragons sees it, well the dog is probably your new space in the backyard next to Mr.down the toilet; fish so that is one reason. The second reason is, if you have any plants of any thing that has some fruits or vegetables they will come and eat your fruits and vegetables just because they want to most of the time they aren't even hungry they are like alligators they will eat till the stomachs explode because they aren't hungry they just want to eat everything they see. The last reason is if you want to go fishing and you have an Komodo Dragons in your neighborhood and there is very few fish in your lake, well most likely it was the Komodo Dragons but it could be the alligators or birds, another reason is because if you have small children or are one you might not want to get into an eye to eye battle with and Komodo Dragons because they sometimes eat what they see so you might become its snack.
If you come across one of these savage beasts you would want to look at it while you back up slowly until you are far enough till you know you can out run it. These beasts are as fast as an alligator so don't think that they won't catch you if you walk away with your eyes off it, it is like a situation with an alligator, you want to look at it and back up slowly till you are far enough distance till you know you can outrun it or if it is chasing you, you should run in zig zags until it tires out then run away to a safe place.
A way to prevent these beasts from being in sight. A way to prevent these from being around is by calling an animal control inspection to scope out where you live and make sure there are no Komodo Dragons or tracks of them either. A way to get rid of them if there are Komodo Dragons is to call animal control and tell them to come get it, but if it is too close to you for that then you want to make loud noises and make yourself as big as you can kind of like a bear.

Answers

Add some more commas and periods. This might fix some run-on sentences in there.

Other Questions
write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women. List and explain the major features that the following building designs must have to relate directly to their functions.-Hospital-Airport-Courthouse A student observes a difference in the activity level of fish at a pet store. The fish in an aquarium near the window are swimming around more quickly tha the fish in an aquarium placed in the back of the store. The student forms a hypothesis about the effect of sunlight on fish activity levels and arranges to conduct an experiment. Which variable could be an independent variable in the student's experiment? types of fish sold speed of swimming fish amount of time fish were active temperature of water in fish tank how do you do this equation ?solving inequalities 8 2x < x + 7 Need help with this math problem Bacteria reproduce in a process called binary fission which of the following is true about binary fission? The expression 17x is equivalent to the expression x 7. What can you infer based on this text?But Buck did not read the newspapers,and he did not know that Manuel, one ofthe gardener's helpers, was an undesirableacquaintance.A. The newspapers magically told about future events.B. Buck doesn't know that Manuel is not a desirableacquaintance.C. Manuel is the new butcher's assistant. How did Mendeleev arrange the known elements in his periodic table? O A. According to the number of protons O B. According to the number of electrons O C. According to atomic mass O D. According to atomic number What did Washington warn against in his Farewell Address?Options:A) Electing the wrong personB) Political party infightingC) Neutrality in foreign warsD) A strong national government(Thank you)