Identify 3 characteristics that plants share with algae.

Answers

Answer 1

Explanation:

I am sure you are clear. Thanks.

Identify 3 Characteristics That Plants Share With Algae.

Related Questions

I am made of many cells, which makes me __________. I make my own food through a process called photosynthesis. This makes me a__________.

Answers

Answer:

multicellular

Explanation:

plant cell

Answer:

I am made of many cells, which makes me multicellular. I make my own food through a process called photosynthesis. This makes me a(n) plant/ autotroph .

Explanation:



Help!

For the global population growth rate to reach zero, the number of births would have to be

Answers

Answer:

same as the number of death

... is what you fill in.

Explanation:

If the death and birth number are equal, there are no changes in numbers made.

For the global population growth rate to reach zero, the number of births would have to be same as the number of death.

What do you mean by population growth rate?

Population growth is the increase in the number of people in a population or dispersed group. Actual global human population growth amounts to around 83 million annually, or 1.1% per year. The global population has grown from 1 billion in 1800 to 7.9 billion in 2020.

Population in the world is, as of 2022, growing at a rate of around 0.84% per year (down from 1.05% in 2020, 1.08% in 2019, 1.10% in 2018, and 1.12% in 2017). The current population increase is estimated at 67 million people per year.

The world's population is expected to increase by nearly 2 billion persons in the next 30 years, from the current 8 billion to 9.7 billion in 2050 and could peak at nearly 10.4 billion in the mid-2080s.

Learn more about population growth rate:

https://brainly.com/question/14122627

#SPJ6

how do interactions among organisms affect their ecosystem

Answers

Answer:

Individual organisms live together in an ecosystem and depend on one another. ... One category of interactions describes the different ways organisms obtain their food and energy. Some organisms can make their own food, and other organisms have to get their food by eating other organisms

Fossils and Evolution On Study Island

A team of scientists are studying three different layers of sedimentary rock to learn about a particular reptile species. In the layer of rock that is closest to the Earth's surface, the reptiles' teeth fossils are found to be short and straight. In the layer below, the reptiles' teeth fossils are found to be long and straight. In the layer below that, the reptiles' teeth fossils are found to be long and curved.


Based on this information, the reptiles today most likely have
A.
long, straight teeth.
B.
no teeth.
C.
long, curved teeth.
D.
short, straight teeth.

Answers

Answer: short, straight teeth

Explanation: study island

What are the consequences of humans adding gases and other substances to earth's atmosphere?

Answers

Answer:

depends which kinds. some can eat the atmosphere like the hole in the atmosphere like the gases from aerosols like hair spray, some trap heat from the sun like greenhouse gases, silver oxide can collect moisture in the air to make rain, air pollution from dense factory and vehicle usage can cause smog and acid rain, fertilizer and pesticide from farms can run off into rivers and other bodies of water

Answer:

1.

2.

Explanation:

. . . .

can exoskeletons break?

Answers

If a large animal such as a human being had a thin light exoskeleton, there would be several problems. Since the exoskeleton would not be able to hold its shape, it would be difficult to keep the vital organs protected and the organism would be subject to damaging levels of stress just by moving around. They are not strong enough to hold organs or hold its shape.

WILL GIVE BRAINLIEST IF CORRECT
The two mice pictured below are genetically identical. How were they produced?

Answers

Answer:

Both of the mice had the same allels by the parents (EE)

Explanation:

Why are viruses not considered living organisms by most people?

Answers

Answer:

Viruses are not considered living organisms because they require a host cell to replicate, unlike living organisms which can replicate on their own.

Can anyone help me with my homework

Answers

Answer:

1) True

2) True

3) False

4) True

5)True

Question 2
Which of the following terms best describes the idea of managing and carefully using Earth's resources?
A
recycling
B
reducing
С
conservation
D
conclusion

Answers

A would be good because recycling is good for the earth and I had this question.

How can a mutation give adults the the ability to digest milk? ​

Answers

A single point mutation in the DNA near the lactase gene changes the cytosine (C) nucleotide to a thymine (T). Individuals with the thymine (T) nucleotide are lactose tolerant and can digest the milk products in adulthood.

learned from science learn written information since Sep 3, 2009 as said there

True or false: Invasive species are harmful in every single environment/ecosystem in the world.

Answers

Answer: the answer is yes

Explanation: in Florida we have multiple different invasive species which are destroying the environment.

True
Because the animal can be harmful to many other species in that ecosystem

An increase in heart rate (your heart pumps faster) results in...

A. No changes to cardiac output or pressure
B. Increase cardiac output and high pressure
C. Increased cardiac output but lower pressure

Answers

Answer:

B

Explanation:

I believe that the answer is B

This oceanic zone contains some of the
deepest parts of the ocean.
A. Kelp Forest
B. Abyssal Zone
C. Coral Reefs

Answers

This correct answer is the Abyssal Zone

The abyssal zone, which lies between 4,000 and 6,000 meters (13,000 and 20,000 feet) below the surface, is the deepest region of the ocean. So, option B is the answer.

The region of the ocean that lies beyond the continental shelf is commonly referred to as the oceanic zone. The sunshine zone, twilight zone, midnight zone, and abyssal zone are the four vertical zones that make up the open ocean.

Abyssal zone is characterized by high pressure, low temperatures, and very little light.

Kelp forest is found in shallower areas, often between 20 and 100 meters deep and Coral reefs are located in tropical, shallow waters.

Therefore, option B is correct.

Learn more about oceanic zone here;

https://brainly.com/question/33307218

#SPJ5

WILL GIVE BRAINLIEST!!!!

Use the drop-down menus below to identify the organ(s) that is/are responsible for each function of the excretory system.

produces feces

excretes sweat

converts poisonous substances to less toxic forms

excretes carbon dioxide and water

produces urine


Answers:
large intestine, skin, liver, lungs, kidney

Answers

Explanation:

large intestine, skin, liver, lungs, kidney

hope it is helpful to you

Answer:

1. Large intestine

2. Skin

3. Liver

4. Lungs

5. Kidney

Explanation:

Bc I said so

You are exposed to the same pathogen twice in your lifetime. Which of the following
is true?

A.) Your body will fight the second exposure much slower because it has already
used up all its antibodies against that antigen.

B.) The reaction times will be almost equal.

C.) You cannot be exposed to the same pathogen twice in your life because you
already destroyed those pathogens with your Killer T cells.

D.) Your body will fight the second exposure much quicker because it has stored
memory cells against that specific antigen.

Answers

Answer:

the answer would be D

Explanation:

Answer:

d

Explanation:

AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Answers

Answer:

what?

Explanation:

The graph represents changes to two jackrabbit populations in two different areas over 15 years.
a. Which of these populations experienced the faster growth rate over the first five years? Explain your answer.
b. Which of these populations probably experienced more births than deaths over the first five years?
c. What is the approximate carrying capacity for each population, as indicated by the graph?
d. At carrying capacity, how would the growth rate of the population in area A compare with the growth rate of the population in area B?
e. Although the two populations started out at the same size, one population grew larger than the other. What are two environmental factors that could have limited the growth of one of these populations?
f. For the population in area A, which part of the chart shows exponential growth and which shows logistic growth?
g. What are two possible changes to environmental factors that could cause the population in area B to experience positive population growth that would allow it to reach the same carrying capacity as the population in area A?

Answers

Answer:

B: blue experienced more death than red

Imma give u brainliest

If anyone answer these questions

Answers

Answer:

it is to do with something called angular moment. Gravity is the central force in the Universe, because it is the only one which has a significant pull over large distances.

5:Orbits are the result of a perfect balance between the forward motion of a body in space, such as a planet or moon, and the pull of gravity on it from another body in space, such as a large planet or star. ... These forces of inertia and gravity have to be perfectly balanced for an orbit to happen.

6;Gravity is the force that keeps planets in orbit around the Sun.

7.gravity

The dynamics of a rotating body is of course controlled by forces like gravity. Kepler's laws are a direct consequence of gravity

8.Rather, the term is derived from the concept of the tide "springing forth." Spring tides occur twice each lunar month all year long, without regard to the season. Seven days after a spring tide, the sun and moon are at right angles to each other

9.Neap tides occur halfway between each new and full moon – at the first quarter and last quarter moon phase – when the sun and moon are at right angles as seen from Earth.

A scientist thinks he has discovered a drug that
interferes with the functioning of a virus in the
human body. To effectively block infection, the
drug can
I
A weaken viral respiration.
B destroy viral mitochondria.
C reduce the ability of the virus to absorb cells.
D prevent the virus from entering cells.

Answers

Answer:

D

Explanation:

https://brainly.com/question/9265902

Condensation is when water changes from a
A. gas to a liquid.

B. liquid to a gas.

Answers

the answer is A. Condensation is when a gas becomes a liquid. It happens when a gas, like water vapor, cools down. ... In condensation, matter changes from a gas to a liquid. All matter is made of tiny moving particles called molecules.

Answer:

ima say its A but if its wrong im srry

Explanation:

What will most likely occur if population density increases in a population that is density dependent?

Birthrate will decrease.
Carrying capacity will increase.
Death rate will decrease.
Immigration will increase.

Answers

Answer:

D

Explanation:

Population density is the number of individuals in a unit square area. As if population density increases in a population that is density-dependent, will increase immigration, i.e., option D.

What is immigration?

Immigration is a process by which individuals become residents of another country permanently.

The process of immigration is of great importance for social, economic, and culture of states.

As population density increases in a population that is density-dependent immigration will also increase.

Thus, the correct option is D.

For more details regarding immigration, visit:

https://brainly.com/question/13688875

#SPJ2

1. What is the food eaten by an organism used for? Multiple choice.
A. Cellular respiration and waste production
B. Waste production and biomass increase
C. Cellular respiration, biomass increase, and waste production
D. Biomass increase and waste production

Answers

Answer:

1. What is the food eaten by an organism used for? Multiple choice.(C)

Explanation:

please click the heart and rate excellent and brainleist to ☺️♨️♨️☺️

(Discussion topic)

Some people worry that the increasing number of cell phones will cause cancer
because of the energy of the radio waves they emit. Cell phones are a new technology
that only recently became widely used. And because cancer takes years to develop, the
amount of risk is not yet known.
K
Research this issue, and summarize what's known so far. In your summary, include
information about the energy of radio waves. Be sure to only use credible sources.
Based on what you learned from your research, do you think people should limit their cell phone use? Why or why not?

Answers

Answer:

No.

Explanation:

No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.

Answer:

No, the increasing number of cell phones will not the cause of cancer because it emits low intensity of radio waves. Radiations such as x-rays, gamma rays, alpha particles, beta particles, and neutrons are responsible for causing damage to the cell and the main cause of cancer. High intensity of radio waves heats up the cells not causing cancer disease so we can conclude that the increasing number of cell phones will not cause cancer disease in humans.

what
is added to make RNA?

Answers

Three of the four nitrogenous bases that make up RNA — adenine (A), cytosine (C), and guanine (G) — are also found in DNA. In RNA, however, a base called uracil (U) replaces thymine (T) as the complementary nucleotide to adenine (Figure 3). ... (Remember, DNA is almost always in a double-stranded helical form.)

I do not know how to answer this question please help asap

Answers

Answer:

It would be Africa

Explanation:

It has the a lot of the color for water scarcity

Hope it helped!

Why would breeders want to introduce mutations into a population?Single line text.

Short answers please

Answers

Answer:

Breeders can increase the genetic variation in a population by inducing mutations, which are the ultimate source of genetic variability

30 points picture shown! only real answers pretty please
The picture below shows the satellite image of ocean surfaces on Earth at Locations A, B, C, and D.

Which of these graphs best models the waves in the four locations?

Answers

Answer:

B

Explanation:

20 points real answers please and thanks
Which statement is true?
- The higher the temperature in water, the higher amount of salinity in the water
- The lower the temperature in water, the higher amount of salinity in the water

Answers

Answer:

First one is right.

Explanation:

When the water molecules of the ocean become heated, they expand thus, they can hold more salt than cold water; and have a higher salinity.

The first one is correct

Match each graph with its correlation coefficient.
+1.0
+0.85
+0.15
-0.50
-1.0

Answers

Answer:

-0.50

Explanation:

For the graph displayed, the most probable value of the correlation Coefficient is - 0.50 ; the line of best fit has a negative skoe and hence will have a negative relationship as the correlation Coefficient is a statistical value which measures the degree of relationship between two variables. Also, the distribution of data in the plot does not give a perfect fit, hence a correlation Coefficient of - 1.0 isn't possible for the distribution shown.

Answer:

fist graph: -0.50

second graph: +0.85

third graph: +0.15

fourth graph: +1.0

fifth graph: -1.0

Explanation:

im pretty sure this is the correct answers

Other Questions
Read the following sentence from the passage and answer the question. Bibliophiles had a chance to meet some of their favorite authors and hear them speak in the museum and visitors' center. Based on the meaning of the root words, what does the word bibliophiles mean? Need answer fast 3. Which image replaces the question mark?As?ABD Transformational leadership is a positive predictor of job performance and organizational commitment. a. Trueb. False According to the excerpt, what is the kings salary? pounds of sterling a year PLS HELP WILL GIVE BRAINLESSGiven 4 < a < 5, 2 < b < 4 Find: a / b name the default Package of java PLEASE NO LINKS!I need someone who is down to experimentYou MUST be a GEMINIand OLDER then 16The reason is I found that a gemini and a sagittarius have a 92% compatibility rate. (comparing all zodiac signs with sagittarius this is the highest) So I want to see how true that is.IF your down let me know please help me please will give brainliest elpac grade 6-8 speaking test answers Use the words flexor and extensor to explain how muscles work in pairs. What town did the Salzburgers create in the new Georgia colony?Your answer:SavannahAtlantaDarienEbenezer 1.3.1 Define the term heat island. (1 x 1)(1) A beryllium atom contains 4 protons, 4 neutrons and 4 electrons. What is the atomic number of beryllium? All the following are secular festivals except:Chinese New YearDiwaliCarnivalCrop Over . Which battle during the Vietnam War is considered to be the worst "friendly fire" event in world history?A. My Lai Massacre B. Tet OffensiveC. Battle of HueD.Battle of Dak Which is the thesis statement in this introductory paragraph?Would you pay hundreds of thousands of dollars for a home that wasfalling apart? Without the benefit of a qualified home inspector, manypeople do just that. Home inspectors check the condition of the home,including the foundation, roof, plumbing, and electrical systems,Though home inspections can be expensive, it is worth it to know if theroof is leaking or there's a problem with the pipes in the basementbefore you purchase the home. Because a home is often the largestsingle investment a person will make in his or her lifetime, theimportance of a proper home inspection cannot be overstated. Which expression below has the same value as 69? another word for not intimidated or discouraged by difficulty Salt was added to the milk after it fermented over night. Does the salt effect thesize of the curds? analyze the reasons compromises and negotiations were unsuccessful in preventing the Civil War.As you write, follow the directions below. Address all parts of the prompt. Include information and examples from your own knowledge of social studies.