if a cell contains 40% glucose what is the rest of the cell made up of ?

Answer:

A

Explanation:

I took the question in a online quiz

Answer:

an estuary

Explanation:

A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.

An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.

Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.

Therefore, the correct option is A.

Learn more about Estuary here:

https://brainly.com/question/17564221

#SPJ6

Answer:

TAAGCGCTA

Explanation:

Answer:

c

Explanation:

Answer:

Primary consumer.

Explanation:

Ok, so a producer is stuff like grass. Then you've got decomposers, which are maggots and vultures and animals like that (ew). Our primary consumer is the bird, then you've got the snake which eats the bird, and then there's the alpha predator, the hawk, which can eat both the snake and the bird. We call the alpha predator the tertiary consumer.

Do you get it now?

Answer:

amino acids

Explanation:

A protease is an enzyme capable of catalyzing the breakdown of proteins into polypeptide fragments and single amino acids, which are the building block of proteins. Proteases act by breaking peptide bonds by a process called hydrolysis, a reaction where water molecules break down peptide bonds (hydro means water and lysis means split). Proteases can be classified depending on the catalytic residue into cysteine, serine, threonine, aspartic, glutamic and metalloproteases.

The product that will be present in the test tube will be amino acids.

Protease is an enzyme that acts on protein by converting it into different

types of amino acids.

Amino acids are referred to as the building block of life and are important

nutrients in growth and replacement of worn-out tissues. The protease acts

on the protein by breaking the peptide bonds under the required

temperature.

An inadequate temperature may result in the denaturing of the enzyme

which was why the test was done at 37°C. This is the body temperature of

humans which led to the formation of amino acids which is absorbed by cells

of the body.

Read more on https://brainly.com/question/20299415

Answer:

Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.

Explanation:

Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.

Answer:

I require more Information on the changes these cells are undergoing

Answer:

true

Explanation:

Molecules are both vehicles for storing and transporting energy, and the means of converting it from one form to another when the formation, breaking, or rearrangement of the chemical bonds within them is accompanied by the uptake or release of heat.

Answer:

true

Explanation: Molecules are two or more atoms held together By chemical bonds.

Answer:

17 m/s

Explanation:

s=d/t

s=34m/2s

Answer:

34/2 = 17 m/s

Explanation:

Distance Covered: s = 34 m

Time in which distance covered: t = 2 s

----

Average Speed: v = Distance Covered/time taken = s/t  

v = 34/2

v = 17 m/s

I hope this helps explain things a little better.

Answer:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Explanation:

This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.

Answer:  c

Explanation:

Answer:

codominance

Explanation:

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.

Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.

Learn more about the antigen here

https://brainly.com/question/30587809

#SPJ2

Answer: A: People with different goals can make contributions to scientific knowledge.

Schwann and Virchow both had different goals for what they were trying to discover, but both ended up adding to the same theory.

Hope this helps :)

Answer:

6 [tex]x^{2}[/tex]  +  7 x  −  20

Lipids don't store genetic informations so the answer is 2

they absorb liposoluble vitamins they offer insulation/cushioning they store energy

Answer:

In our respiratory system, carbon dioxide is the waste material that we expel when we breathe out. The answer is C, Carbon Dioxide

I hope you have a great day!

The waste product of respiration is

C. Carbon dioxide

The oxygen consumed via stomata is used up by cells.

Oxygen from the air enters a leaf through stomata and reaches all the cells by the process of diffusion. This oxygen is used in respiration in cells of the leaf. The carbon dioxide produced during diffuses out from the leaf into the air through same stomata. The oxygen used by cells in the leaves to disintegrate glucose into water and carbon dioxide.

Thus, option C is correct.

Find more information about Respiration here:

brainly.com/question/18169685

Answer:

the second, fourth and fifth ones are balanced.

Answer:

the first, second, fourth, and fifth

Answer:

ATP and NADPH

Explanation:

they use it to reduce carbon dioxide and convert the energy into chemical bond energy in carbohydrates such as glucose

Answer: It’s not in shape like it’s cut out

Explanation:

Answer:

he could not complete it cut he out of shape

Answer:because time and society are different

Explanation:

Answer:

many things..........

Answer:

C

Explanation:

hope this helps

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.

Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.

The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.

Learn more about biomes, here:

https://brainly.com/question/18601179

#SPJ6

Answer:The energy change in a chemical reaction is due to the difference in the amounts of stored chemical energy between the products and the reactants. This stored chemical energy, or heat content, of the system is known as its enthalpy.

Explanation:

Answer: The energy in this reaction (photosynthesis) comes from light.

Sorry about cutting it close, hope this helps.

Answer:

predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.

Explanation:

Answer:

keystone species

Explanation:

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer: B || Geothermal energy comes from the internal heat of Earth.

Explanation:

hope it helped xx :))

Answer:

15

Explanation:

Gametes have half the amount of dipliod somatic ells